Res. Plant Dis > Volume 31(1); 2025 > Article
Alternaria alternata에 의한 동백나무 잎점무늬병 국내 발생 보고

요 약

2023년 5월 전남 순천시의 동백나무 (Camellia japonica) 잎에서 점무늬병이 관찰되었다. 원인 병원균을 동정하기 위해 병징이 나타난 잎에서 병원균을 분리하였다. 형태적 특성과 계통학적 분석을 통해 원인 병원균이 Alternaria alternata로 밝혀졌다. 병원성 검정을 통해 A. alternata가 원인 병원균임을 확인하였으며, 감염된 잎에서 동일한 병원균을 재분리하여 Koch의 법칙을 충족하였다. 이 연구는 우리나라에서 C. japonica의 잎점무늬병 원인 병원균이 A. alternata임을 보고한 첫 번째 사례이다. 이 결과는 앞으로 동백나무 잎점무늬병에 대한 효과적인 방제 전략 개발에 기여할 것이다.

ABSTRACT

In May 2023, leaf spot disease was observed on the leaves of camellia trees (Camellia japonica) in Suncheon-si, Jeonnam Province. To identify the fungal species responsible for the disease, we isolated samples from the diseased leaves. Based on morphological characteristics and phylogenetic analysis, we identified the causal fungus of leaf spot disease as the ascomycete Alternaria alternata. Pathogenicity assays confirmed that the isolates were the causal agents of leaf spot disease, and the fungus was reisolated from the infected leaves, thus fulfilling Koch's postulates. To our knowledge, this is the first report of A. alternata as the causal pathogen of leaf spot disease on C. japonica in Korea. Our results will contribute to the development of effective control strategies for this disease in the future.

동백나무 (Camellia japonica)는 차나무과 동백나무속에 속하는 쌍떡잎 여러해살이 식물로, 원산지는 중국이며 한국, 일본을 포함한 동아시아에 주로 분포하고 있다(Abe 등, 2024). 동백나무는 10월 초부터 다음 해 4월까지 붉은색, 분홍색, 흰색의 꽃을 피우며, 열매는 세 쪽의 검은색 씨가 들어 있다. 다양한 품종이 개발되어 주로 관상용으로 재배되며 꽃은 차로, 열매는 기름을 추출하여 약용으로 이용되고 있다(Lee 등, 2011).
2023년 5월, 전남 순천시 순천만국가정원(34.92970° N, 127.50955° E)에 식재된 동백나무의 잎에서 점무늬 병징이 전체 잎의 약 10-15%에서 관찰되었다(Fig. 1A). 잎 점무늬 병반의 크기는 직경 1 mm에서 8 mm까지 다양하였으며, 시간이 지날수록 점무늬가 점차 확대되었다(Fig. 1A). 원인 병원균을 구명하기 위해 점무늬 병징에서 병원균을 분리하였다. 먼저 감염된 잎을 5×5 mm 크기로 잘라 70% 에탄올과 1% 차아염소산나트륨(NaClO)으로 각각 1분간 소독한 후, 멸균수로 3회 세척하였다. 이후, 100 µg/ml 농도의 streptomycin을 포함한 1% 물 한천 배지에 치상하여 25 o C에서 3-5일간 배양하였다. 자라난 균사는 8% V8 juice agar 배지(Campbell's V8 juice 80 ml, 한천 15 g, 증류수 1 l, 0.1N NaOH로 pH 7.0으로 조정)에 배양하여 단포자 분리를 통해 총 5개의 균주(SYP-1495, SYP-1496, SYP-1497, SYP-1498, SYP-1499)를 순수 분리하였다.
Fig. 1.
Naturally occurring leaf spot symptom on Camellia japonica and morphological characteristics of Alternaria alternata. (A) Leaf spot symptoms on leaves of Camellia japonica. The red arrowheads indicate the leaf spot symptoms. The symptom observed in the lower right quadrant is an enlargement of the white circle shown in the photograph. The front (B) and reverse (C) side of a 10-day-old colony on potato carrot agar medium. (D) Conidia of SYP-1495 on V8 medium. (E) Conidial chain of SYP-1495 on KCl medium at 25 o C for 3 days.
RPD-2025-31-1-118f1.jpg
형태학적인 특징을 관찰하기 위해, 분리한 병원균의 균총과 포자를 감자 당근 한천 배지(감자 20 g, 당근 20 g, 한천 15 g; 증류수 1 l)에서 25 o C에서 10일간 암상태로 배양하였다. 분리한 병원균의 균총은 중앙 부위가 어두운 회색을 띠었으며, 말단 부위 방향으로 점차 밝은 회갈색에서 흰색을 나타냈다(Fig. 1B, C). 포자는 갈색 또는 황갈색으로, 격벽이 있는 곤봉형 또는 타원형이었으며, 가로 격벽은 1-5개, 세로 격벽은 0-2개였다(Fig. 1D, E). KCl 한천 배지(KCl 6 g, 한천 15 g, 증류수, 1 l)에 배양하였을 때, 균사로부터 분생포자경이 발생하여 4-6개의 포자 사슬이 관찰되었다(Fig. 1E). 병원균의 포자 크기는 13.5-37.5×5.4-14.0 µm (평균 22.9×5.1 µm, n=100)로 측정되었다. 이러한 형태학적인 특성은 Alternaria spp.의 형태학적인 특성과 일치하였다(Woudenberg 등, 2013, 2014, 2015).
형태학적으로 Alternaria 속으로 동정된 병원균의 분자생물학적 동정을 위해 ribosomal RNA의 small subunit (SSU), large subunit (LSU) internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase (gapdh), translation elongation factor 1-alpha (tef1), RNA polymerase second largest subunit (rpb2), Alternaria major allergen gene 1 (Alt a 1), endopolygalacturonase (endoPG), anonymous gene region (OPA10-2)을 포함한 총 9개 Alternaria의 종 동정을 위한 분자 마커 유전자를 증폭할 수 있는 프라이머 정보(Table 1)를 활용하여 본 연구에서 분리한 5개 균주로부터 중합효소 연쇄 반응(polymerase chain reaction, PCR) 증폭 산물을 확보하였다.
Table 1.
Primers used for PCR and sequencing
Locus Primer Primer sequence (5’-3’) Reference
SSU NS1 GTAGTCATATGCTTGTCTC White et al. (1990)
NS4 CTTCCGTCAATTCCTTTAAG
LSU LSU1Fd GRATCAGGTAGGRATACCCG Crous et al. (2009)
LR5 ATCCTGAGGGAAACTTC Vilgalys and Hester (1990)
ITS V9G TTACGTCCCTGCCCTTTGTA de Hoog and Gerrits van den Ende (1998)
ITS4 CCTCCGCTTATTGATATGC White et al. (1990)
gapdh gpd1 CAACGGCTTCGGTCGCATTG Berbee et al. (1999)
gpd2 GCCAAGCAGTTGGTTGTGC
tef1 EF1-728F CATCGAGAAGTTCGAGAAGG Carbone and Kohn (1999)
EF1-986R TAC TTG AAG GAA CCC TTA CC
rpb2 RPB2-5F2 GGGGWGAYCAGAAGAAGGC Sung et al. (2007)
fRPB2-7cR CCCATRGCTTGTYYRCCCAT
Alt a 1 Alt-For ATGCAGTTCACCACCATCGC Hong et al. (2005)
Alt-Rev ACGAGGGTGAYGTAGGCGTC
endoPG PG3 TACCATGGTTCTTTCCGA Andrew et al. (2009)
PG2b GAGAATTCRCARTCRTCYTGRTT
OPA10-2 OPA 10-2R GATTCGCAGCAGGGAAACTA Andrew et al. (2009)
OPA 10-2L TCGCAGTAAGACACA TTCTACG

PCR, polymerase chain reaction; SSU, small subunit ribosomal RNA; LSU, large subunit ribosomal RNA; ITS, internal transcribed spacer region; gapdh, glyceraldehyde 3-phosphate dehydrogenase; tef1, translation elongation factor 1-alpha; rpb2, RNA polymerase second largest subunit; Alt a 1, Alternaria major allergen gene 1; endoPG, endopolygalacturonase; OPA10-2, anonymous region.

PCR 증폭 산물의 염기서열은 바이오니아(Bioneer Inc., Dae-jeon, Korea)의 염기서열 분석 서비스를 통해 분석하였다. 확보된 염기서열은 DNAStar (Madison, WI, USA)의 SeqMan 프로그램을 사용하여 양방향의 염기서열을 조립하고 편집하였다. 본 연구에서 확보된 염기서열 정보는 모두 미국 국립생명공학정보센터(National Center for Biotechnology Information [NCBI]; http://www.ncbi.nlm.nih.gov/)에 등록하였다(Table 2).
Table 2.
Strains used in this study and their GenBank accession numbers
Name Strain number GeneBank accession numbers
SSU LSU ITS gapdh tef1 rpb2 Alt a1 endoPG OPA10-2
Alternaria sp. SYP-1495 PV172330 a PV172335 a PV172340 a PV175757 a PV175762 a PV175767 a PV175772 a PV175777 a PV175782 a
SYP-1496 PV172331 a PV172336 a PV172341 a PV175758 a PV175763 a PV175768 a PV175773 a PV175778 a PV175783 a
SYP-1497 PV172332 a PV172337 a PV172342 a PV175759 a PV175764 a PV175769 a PV175774 a PV175779 a PV175784 a
SYP-1498 PV172333 a PV172338 a PV172343 a PV175760 a PV175765 a PV175770 a PV175775 a PV175780 a PV175785 a
SYP-1499 PV172334 a PV172339 a PV172344 a PV175761 a PV175766 a PV175771 a PV175776 a PV175781 a PV175786 a
A. alternata CBS 102598 T KP124951 KP124481 KP124329 KP124184 KP125105 KP124797 KP123878 KP124031 KP124638
A. alternata CBS 102600 T KP124953 KP124483 KP124331 KP124186 KP125107 KP124799 KP123880 KP124033 KP124640
A. alternata CBS 118814 T KP124979 KP124509 KP124357 KP124211 KP125133 KP124825 KP123906 KP124059 KP124669
A. alternata CBS 916.96 T KC584507 DQ678082 AF347031 AY278808 KC584634 KC584375 AY563301 JQ811978 KP124632
A. alternata CBS 918.96 R KC584567 KC584311 AF347032 AY278809 KC584693 KC584435 AY563302 KP124026 KP124633
A. alternata CBS 119543 T KP124985 KP124515 KP124363 KP124215 KP125139 KP124831 KP123911 KP124065 KP124674
A. alternata CBS 106.24 T KP124919 KP124449 KP124298 KP124155 KP125073 KP124766 KP123847 AY295020 JQ800620
A. alstroemeriae CBS 118809 T KP124918 KP124448 KP124297 KP124154 KP125072 KP124765 - KP123994 KP124602
A. alternantherae CBS 124392 KC584506 KC584251 KC584179 KC584096 KC584633 KC584374 KP123846 - -
A. arborescens CBS 102605 T KC584509 KC584253 AF347033 AY278810 KC584636 KC584377 AY563303 AY295028 KP124712
A. betae-kenyensis CBS 118810 T KP125042 KP124572 KP124419 KP124270 KP125197 KP124888 KP123966 KP124123 KP124733
A. burnsii CBS 107.38 T KP125043 KP124573 KP124420 JQ646305 KP125198 KP124889 KP123967 KP124124 KP124734
A. eichhorniae CBS 489.92 T KP125049 KP124579 KC146356 KP124276 KP125204 KP124895 KP123973 KP124130 KP124740
A. gaisen CBS 118488 R KP125051 KP124581 KP124427 KP124278 KP125206 KP124897 KP123975 KP124132 KP124743
A. gossypina CBS 104.32 T KP125054 KP124584 KP124430 JQ646312 KP125209 KP124900 JQ646395 KP124135 KP124746
A. iridiaustralis CBS 118486 T KP125059 KP124589 KP124435 KP124284 KP125214 KP124905 KP123981 KP124140 KP124751
A. jacinthicola CBS 133751 T KP125062 KP124592 KP124438 KP124287 KP125217 KP124908 KP123984 KP124143 KP124754
A. longipes CBS 540.94 R KC584541 KC584285 AY278835 AY278811 KC584667 KC584409 AY563304 KP124147 KP124758
A. avenicola CBS 121459 T KC584512 KC584256 KC584183 KC584100 KC584639 KC584380 - - -
A. brassicicola CBS 118699 R KC584515 KC584259 JX499031 KC584103 KC584642 KC584383 - - -
A. infectoria CBS 210.86 T KC584536 KC584280 DQ323697 AY278793 KC584662 KC584404 - - -
A. papavericola CBS 116606 T KC584579 KC584321 FJ357310 FJ357298 KC584705 KC584446 - - -
A. solani CBS 109157 T - - KJ718238 GQ180080 KJ718585 KJ718413 KJ718746 - -

T: ex-type strain; R: representative strain.

SSU, small subunit ribosomal RNA; LSU, large subunit ribosomal RNA; ITS, internal transcribed spacer region; gapdh, glyceraldehyde 3-phosphate dehydro tion factor 1-alpha; rpb2, RNA polymerase second largest subunit; Alt a 1, Alternaria major allergen gene 1; endoPG, endopolygalacturonase; OPA10-2, an a ogenase; tef1, translation elonganonymous region.

a They are generated in this study.

확보된 염기서열을 NCBI의 Basic Local Alignment Search Tool에서 검색한 결과, 5개의 순수 분리 균주(SYP-1495~SYP-1499)의 SSU (GenBank accession no. PV172330-PV172334), LSU (PV172335-PV172339), ITS (PV172340-PV172344), gapdh (PV175757-PV175761), tef1 (PV175762-PV175766), rpb2 (PV175767-PV175771), Alt a1 (PV175772-PV175776), endoPG (PV175777-PV175781), OPA10-2 (PV175782-PV175786) 염기서열은 Alternaria alternata CBS 918.96 균주의 염기서열(AF347032, AY278809, KC584693, KC584435, AY563302, KP124026, KP124633)과 각각 100% (1020 bp/1020 bp), 100% (853/853), 100% (519/519), 100% (583/583), 100% (240/240), 100% (830/830), 95.32% (448/470), 99.33% (445/448), 100% (634/634)로 일치하였다. 염기서열 결과를 기반으로 병원균을 잠정적으로 Alternaria alternata로 동정하였다.
염기서열에 기반한 계통분류학적 분석을 위해, GenBank 데이터베이스에서 Alternaria section Alternata (Woudenberg 등, 2015)와 section Porri (Woudenberg 등, 2014)로부터 ex-type strain들 및 대표 균주(representative strain)들로부터 염기서열을 확보한 후, 총 7개의 염기서열 정보(ITS, gapdh, tef1, rpb2, Alt a1, endoPG, OPA10-2)는 Clustal X (Thompson 등, 1997)를 이용하여 다중 염기서열 정렬을 수행하였다. 계통분류학적 분석은 MEGA X 프로그램(https://www.megasoftware.net)을 이용하여 Maximum likelihood 방법으로 진행하였다. 그 결과, 분리된 병원균 SYP-1495~SYP-1499 균주 모두는 A. alternata CBS 918.96(이전 A. tenuissima의 대표 균주)과 묶여 A. alternata임을 다시 한번 확인하였다(Fig. 2A).
Fig. 2.
Phylogenetic analysis and pathogenicity test. (A) A maximum likelihood (ML) tree was constructed using MEGA X. The tree was built using the concatenated sequences of ITS, GAPDH, TEF1, RPB2, Alta, endoPG and OPA10-2 generated from isolates SYP-1495~SYP-1499 as well as the corresponding sequences of Alternaria spp. downloaded from GenBank. Clades containing A. alternata and the present isolates are shaded. Bootstrap value=1,000. The number at each node represents a bootstrap value. Ex-type strains are indicated with T. Representative strains are indicated with R. Mock inoculation (B) without and (C) with wounds. Inoculation of leaves with A. alternata culture block, both without (D) and with (E) wounds, at 7 days post-inoculation. The red arrowheads indicate the site of inoculation.
RPD-2025-31-1-118f2.jpg
순수 분리된 균주가 원인 병원균임을 증명하기 위해, 5개의 균주 중 SYP-1495를 대표 균주로 선정하여 병원성 검정을 수행하였다. 접종할 병원균 SYP-1495 균주를 potato dextrose agar (PDA) 배지에서 25 o C로 3일간 배양한 후, 직경 5 mm의 코르크볼러를 이용하여 균사 배양체를 준비하였다. 기주 식물인 동백나무의 1년생 가지의 잎에 병원성 검정을 수행하였다. 접종 전 동백나무의 잎과 가지 표면을 70% 에탄올에 3분간 담근 후, 멸균 증류수를 이용하여 표면을 씻고 말린 후 사용하였다. 병원균 접종은 기주 식물에 무상처 접종과 상처 접종으로 나누어 수행하였다. 상처 접종의 경우, 잎 표면에 멸균된 수지침 바늘(0.18×8 mm; Qingdao Dongbang Medical Co., Ltd., Shan-dong, China)을 이용하여 10번 찔러 상처를 낸 뒤, 음성 대조군에는 경우 직경 5 mm의 아무것도 접종하는 않은 PDA 배지를 접종하였고, 실험군에는 직경 5 mm의 SYP-1495 균사 배양체를 접종하였다. 접종 후, 온도는 28 o C, 상대 습도 100% 조건에서 2일간 배양한 후 잎 위의 접종원을 제거하였다. 그 후 동일한 조건에서 5일 동안 배양한 뒤 병징을 확인하였다.
음성 대조군에서는 어떠한 병징도 관찰되지 않았으나(Fig. 2B, C), SYP-1495를 무상처 및 상처 접종한 잎에서는 점무늬 병징이 관찰되었다(Fig. 2D, E). 특히, SYP-1495 균주를 상처 접종한 잎의 점무늬 병징은 최초 관찰된 동백나무 점무늬 병징과 매우 유사하였다(Fig. 2D, E). 병징이 나타난 감염 잎으로부터 병원균을 재분리한 후, 단포자를 분리하여 ITS, gapdh, tef1, rpb2, Alt a1, endoPG, OPA10-2 영역을 PCR로 증폭한 결과, SYP-1495 균주의 염기서열과 완벽히 일치하여 Koch의 법칙을 만족하였다.
다범성 병원균인 Alternaria 속은 자낭균(Ascomycetes)에 속하는 식물 곰팡이 병원균으로, 주로 식물의 잎을 가해하는 것으로 알려져 있다(DeMers, 2022). 특히, Alternaria 속 균은 식물 잎에 존재하지만 부생성이 강하여 아무런 병징이 나타나지 않다가, 생장이 적합한 온도(20-30 o C)와 높은 상대습도(80% 이상)가 지속될 경우 기생성 병원균으로 변모하여 다양한 병을 일으킨다(Fagodiya 등, 2022). 최근 우리나라에서도 겨울 작물인 보리, 밀, 귀리를 포함한 맥류에서 Alternaria spp.에 의한 병해가 보고되고 있으며(Jeong 등, 2024), 감자에서도 A. alternata 에 의한 잎점무늬병이 보고되었다(Choi 등, 2023). 이는 지금까지 부생균으로 알려진 Alternaria가 기후 변화에 따라 잠재적 주요 병원균이 될 가능성을 시사한다. Alternaria에 의한 동백나무 잎점무늬병의 경우 이탈리아에서는 보고되었으나(Garibaldi 등, 2007), 우리나라에서는 아직 보고된 바가 없다. 따라서, 본 연구는 국내 최초로 A. alternata에 의해 발생한 동백나무 잎점무늬병을 보고하고자 한다. 이 연구는 앞으로 잠재적 문제 병원균인 동백나무 잎점무늬병균 A. alternata 유전자원 확보 및 방제제 개발에 기여할 것이다.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This work was supported by a research promotion program of Sunchon National University (SCNU).

REFERENCES

Abe, H., Ueno, S., Matsuo, A., Hirota, S. K., Miura, H., Su, M. H. et al. 2024. Evolutionary histories of Camellia japonica and Camellia rusticana . Ecol. Evol. 14: e70721.
pmid pmc
Andrew, M., Peever, T. L. and Pryor, B. M. 2009. An expanded multi-locus phylogeny does not resolve morphological species within the small-spored Alternaria species complex. Mycologia 101: 95-109.
crossref pmid
Berbee, M. L., Pirseyedi, M. and Hubbard, S. 1999. Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehyde-3-phosphate dehydrogenase gene sequences. Mycologia 91: 964-977.
crossref
Carbone, I. and Kohn, L. M. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553-556.
crossref
Choi, J., Jeong, M.-H., Choi, E. D., Park, J. and Park, S.-Y. 2023. First report of brown spot caused by Alternaria alternata on potato (Solanum tuberosom L.) in Korea. Plant Dis. 107: 2253.
Crous, P. W., Schoch, C. L., Hyde, K. D., Wood, A. R., Gueidan, C., de Hoog, G. S. et al. 2009. Phylogenetic lineages in the Capnodiales . Stud. Mycol. 64: 17-47.
crossref pmid pmc
de Hoog, G. S. and Gerrits van den Ende, A. H. 1998. Molecular diagnostics of clinical strains of filamentous Basidiomycetes. Mycoses 41: 183-190.
crossref pmid
DeMers, M. 2022. Alternaria alternata as endophyte and pathogen. Microbiology 168: 001153.
crossref pmid pmc
Fagodiya, R. K., Trivedi, A. and Fagodia, B. L. 2022. Impact of weather parameters on Alternaria leaf spot of soybean incited by Alternaria alternata . Sci. Rep. 12: 6131.
crossref pmid pmc pdf
Garibaldi, A., Gilardi, G. and Gullino, M. L. 2007. First report of Alternaria leaf spot on Camellia in Italy. Plant Dis. 91: 324.
crossref pmid
Hong, S. G., Cramer, R. A., Lawrence, C. B. and Pryor, B. M. 2005. Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 42: 119-129.
crossref pmid
Jeong, M.-H., Choi, E. D., Jang, S.-H., An, S., Jo, M., Kim, S. et al. 2024. Survey of fungal diseases on barley, wheat, and oats at tillering to stem extension stages in Southern regions of Korea during 2020-2021. Res. Plant Dis. 30: 207-218. (In Korean)
crossref pdf
Lee, H.-H., Cho, J.-Y., Moon, J.-H. and Park, K.-H. 2011. Isolation and identification of antioxidative phenolic acids and flavonoid glycosides from Camellia japonica flowers. Hortic. Environ. Biotechnol. 52: 270-277.
crossref pdf
Sung, G.-H., Sung, J.-M., Hywel-Jones, N. L. and Spatafora, J. W. 2007. A multi-gene phylogeny of Clavicipitaceae (Ascomycota, Fungi): Identification of localized incongruence using a combinational bootstrap approach. Mol. Phylogenet. Evol. 44: 1204-1223.
crossref pmid
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25: 4876-4882.
crossref pmid pmc
Vilgalys, R. and Hester, M. 1990. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J. Bacteriol. 172: 4238-4246.
crossref pmid pmc pdf
White, T. J., Bruns, T., Lee, S. and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: A Guide to Methods and Applications, eds. by M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White, pp. 315-322. Academic Press, New York, NY, USA.
crossref
Woudenberg, J. H., Groenewald, J. Z., Binder, M. and Crous, P. W. 2013. Alternaria redefined. Stud. Mycol. 75: 171-212.
crossref pmid pmc
Woudenberg, J. H., Seidl, M. F., Groenewald, J. Z., de Vries, M., Stielow, J. B., Thomma, B. P. et al. 2015. Alternaria section Alternaria: species, formae speciales or pathotypes? Stud. Mycol. 82: 1-21.
crossref pmid pmc
Woudenberg, J. H., Truter, M., Groenewald, J. Z. and Crous, P. W. 2014. Large-spored Alternaria pathogens in section Porri disen-tangled. Stud. Mycol. 79: 1-47.
crossref pmid pmc


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next