Res. Plant Dis > Volume 30(2); 2024 > Article
2021년 국내 포도원에서의 5종 포도 바이러스 감염 실태 조사

요 약

본 연구에서는 2021년 충청북도 및 경상북도에 위치한 7개 지역의 총 29개 포도 과원에서 재배되고 있는 포도 5개 품종에서 총 217의 시료를 채집하였다. 바이러스의 진단을 위해서 5종 바이러스에 대한 종 특이프라이머를 이용하여 중합효소연쇄반응하였다. 진단 결과 grapevine fleck virus (GFkV)는 126개 시료(58.06%)에서, grapevine leafroll-associated virus (GLRaV)-3는 112개 시료(51.61%)에서, GLRaV-1는 4개 시료(1.84%)에서 확인되었다. 특히 샤인머스캣과 알렉산드리아 품종에서의 감염률이 높았으며, 지역별로는 경북 지역이 높은 감염률을 보였다. 그러나 grapevine red blotch virus (GRBV)와 grapevine berry inner necrosis virus (GINV)는 확인되지 않았다.

ABSTRACT

In this study, a total of 217 samples were collected from five grapevine cultivars in Chungcheongbuk-do and Gyeongsangbuk-do in 2021. These samples were tested for the presence of five grapevine viruses using specific primers through polymerase chain reaction. The results indicated that grapevine fleck virus was confirmed in 126 samples (58.06%), grapevine leafroll-associated virus (GLRaV)-3 in 112 samples (51.61%) and GLRaV-1 in four samples (1.84%). The infection rate was high in Shine Muscat and Alexandria cultivars, and by region, the Gyeongbuk region showed a high infection rate. However, the presence of grapevine red blotch associated virus and grapevine berry inner necrosis virus were not detected.

포도(Vitis vinifera)는 세계적으로 주요한 원예 작물로서 포도주 생산과 신선한 생과를 위한 중요한 재배 작물로 인정받고 있다(Myles 등, 2011; This 등, 2006). 국내에서 포도 재배 면적은 13,349 ha이며, 충북과 경북 지역이 전체의 약 67%를 차지하고 있다. 특히 캠벨얼리 품종이 42.8%의 비율로 가장 많이 재배되고 있으며, 최근에는 샤인머스캣에 대한 소비자의 선호도가 급증함에 따라 해당 품종의 재배 면적이 증가하고 있다(Korean Statistical Information Service, 2021). 포도에서는 전 세계적으로 80여 종의 바이러스 및 바이로이드가 보고되어 있다(Fuchs, 2020; Krenz 등, 2014; Martelli, 2017). 그중에서도 grapevine berry inner necrosis virus (GINV)는 일본 야마나시에서 가장 경제적으로 중요한 포도나무 바이러스로 알려져 있으며, 중국에서도 보고되었다(Fan 등, 2017). GINV는 국내에서는 2021년 수입된 포도 묘목에서 검출되었으며, 현재는 검역병해충으로 지정되어 있다. 국내에서는 grapevine leafroll-associated virus (GLRaV)-1, GLRaV-3, grapevine fleck virus (GFkV)를 포함하여 20종의 바이러스 및 바이로이드가 발생하는 것으로 알려져 있다(Kim 등, 2011, 2021). 종자산업법 종자관리요강에 따라 GLRaV-1, GLRaV-3, GFkV는 국내 포도 무병묘의 원활한 생산 및 유통을 위해 포도에서 검사하는 특정 병으로 지정되어 있다. Grapevine red blotch virus (GRBV)는 DNA 바이러스로 포도 잎에 붉은 반점을 일으켜 포도 생산에 큰 피해를 입히는 위험성이 높은 바이러스로 알려져 있고, 국내에서는 2016년에 처음 보고되었다(Table 1). 이러한 바이러스로 인한 포도병은 잎과 나뭇가지의 기형, 잎의 변색, 위축 등을 유발하여 열매의 생산량과 당도 등 품질에 심각한 영향을 미칠 수 있다(Basso 등, 2017). 포도는 주로 가지를 발근하여 삽목을 통해 재배되며, 영양 번식 작물로서 바이러스 감염에 취약하다(Myles 등, 2011). 또한 바이러스는 화학적 방제가 어렵기 때문에 건전한 대목과 접수를 이용하여 묘목을 생산하고, 병에 걸린 나무를 제거하여 이차 감염을 방지하는 것이 중요하다. 이를 위해서 조기에 감염 여부를 진단하는 것이 필수적이다. 또한 국내 여러 식물에서 다양한 DNA 바이러스가 유입되어 급증하고 있는 상황에서, 포도에서 GRBV의 감염 실태를 조사는 상당히 큰 의미를 가지고 있다. 따라서 본 연구는 국내 포도 과원을 대상으로 피해가 심한 국내 발생 바이러스(4종) 및 유입 우려 바이러스(1종)의 발생 정도를 조사하여 어떤 종류의 바이러스가 어떤 품종에서 퍼져 있는지를 이해함으로써 포도 바이러스에 대한 예방 및 대응 전략을 수립하고자 한다.
Table 1.
List of grapevine viruses reported in Korea
Family Genus Virus Reference
Betaflexiviridae Foveavirus Grapevine virus T Jo et al. (2017c)
Grapevine rupestris stem pitting-associated virus Jo et al. (2017b)
Trichovirus Grapevine Pinot gris virus Cho et al. (2013)
Vitivirus Grapevine virus B Jo et al. (2018b)
Grapevine virus E Jo et al. (2017d)
Grapevine virus L Kim and Heo (2022)
Closteroviridae Ampelovirus Grapevine leafroll-associated virus 1 Kim et al. (2021)
Grapevine leafroll-associated virus 3 Kim et al. (2004)
Closterovirus Grapevine leafroll-associated virus 2 Kim et al. (2021)
Geminiviridae Grablovirus Grapevine red blotch virus Lim et al. (2016)
Maldovirus Grapevine Gemini virus A Jo et al. (2018a)
Secoviridae Fabavirus Grapevine fabavirus Jo et al. (2017e)
Nepovirus Blueberry leaf mottle virus Kwak et al. (2016)
Tymoviridae Marafivirus Grapevine rupestris vein feathering virus Cho et al. (2018)
Grapevine Syrah virus 1 Cho et al. (2019)
Maculavirus Grapevine fleck virus Jo et al. (2017a)
Pospiviroidae Apscaviroid Grapevine yellow speckle viroid 1 Jo et al. (2017a)
Grapevine yellow speckle viroid 2 Jeong et al. (2022)
Hostuviroid Hop stunt viroid Kim et al. (2011)
2021년 충북 지역(영동, 옥천, 진천, 청주) 및 경북 지역(김천, 상주, 영천)에 위치한 7개 지역의 총 29개 포도 과원에서 재배되고 있는 포도 5개 품종(캠벨얼리, 충랑, 샤인머스캣, 알렉산드리아, 자옥)에서 이상 증상을 보이는 잎 시료 총 217점을 채집하였다. 각각 잎 시료는 액체질소를 이용하여 막자와 막자사발로 마쇄한 뒤, 게놈 추출 키트(BCS Plant RNA Prep Kit; Biocubesystem Co., Suwon, Korea 또는 viral Gene-spin Viral DNA/RNA Extraction kit; iNtRON Biotechnology, Seongnam, Korea) 등을 이용하여 total RNA/DNA를 추출하였다. 바이러스의 진단을 위해서 5종 바이러스에 대한 종 특이프라이머를 사용하였고(Table 2), GRBV에 대해 polymerase chain reaction (PCR) 및 GFkV, GLRaV-1, GLRaV-3, GINV 진단을 위해 reverse transcription (RT)-PCR을 진행하여 전기영동을 통해 결과를 확인하였다. 증폭된 PCR 산물은 정제 후 sanger sequencing 으로 염기서열을 확인하여 바이러스의 감염 여부를 확정하였다. 채집된 시료 중에 일부는 황화, 퇴록, 기형 등의 이상 증상을 보였으나, 바이러스에 특이적인 병징을 확인할 수 없었다. 그리고 이상 증상이 나타나지 않은 다른 시료에서도 바이러스가 진단되었다. 바이러스 종류별 감염률은 GFkV 58.06%, GLRaV-3 51.61%, GLRaV-1 1.84%의 순이었으며, GLRaV-1는 캠벨얼리(영동, 1점), 샤인머스캣(상주, 3점) 총 4점에서만 진단되었다. 포도 5 품종의 5종 바이러스에 대한 감염률을 보면, 캠벨얼리, 충랑 및 자옥은 27-38%의 감염률을 보였으며, 샤인머스캣과 알렉산드리아는 각각 82.1%와 60.0%로 상대적으로 높은 감염률을 나타내었다(Table 3). 지역별로 보면, 충북 4개 지역에서 총 시료 99점 중 51점이 바이러스 감염되어 50% 감염률을 나타났고, 경북 3개 지역에서는 총 118점에서 90점에서 바이러스가 진단되어 76.2% 감염률을 나타냈다(Table 4). 포도는 주로 삽목을 통해 재배하므로, 지역적 차이보다는 어떤 품종을 재배하고, 어떤 묘목을 사용하였는지에 따라 바이러스 감염률이 달라질 것으로 예상된다. 2014년 국내에서 처음으로 진단된 이후 GRBV 의 국내 분포에 대한 정보가 없었지만 이번에 수행된 29개 포도 과원(5개 품종)의 217점 시료에 대한 조사 결과, GRBV는 최근 다양한 DNA 바이러스의 국내 유입이 급증하고 있는 상황이지만, 이번 조사에서는 확인되지 않았다. 또한 GINV는 일본과 중국에서만 발견되는 바이러스로 인접한 국가이며, 포도 묘목의 수입이 활발히 이뤄지고 있는 실정을 고려할 때 국내 유입 가능성이 있었지만, GINV도 확인되지 않았다(Table 3). 반면 GFkV, GLRaV-1, GLRaV-3 3종의 바이러스는 종자산업법에서 없어야 한다고 규정하고 있음에도 농가 포장에서 다수 검출되는 것으로 보아, 무병묘 생산과 검사가 완벽하지 않다고 보인다. 본 연구의 결과로 볼 때, 2014년 포도 시료에서 검출된 GRBV는 국내 포도 과원에 확산되지 않은 것으로 판단되며, GINV는 국경검역을 통하여 국내 유입이 차단되고 있는 것으로 판단된다. 본 연구는 국내 포도 농업에서 중요한 의미를 가지며, 해당 바이러스들에 대한 대응 및 관리 전략을 수립하는 데 유용한 정보로 활용될 수 있다. 특히, 국내 포도 무병묘 개발 등 포도 산업의 지속적인 발전과 바이러스로 인한 피해 최소화에 기여할 수 있을 것이다.
Table 2.
Primer information used to detect grapevine viruses in this study
Virus Primer Sequence (5′→3′) Size (bp) Tm (°C) Reference
GFkV GFkV-2F CTCCCCTTCCAGTTCCTGTGGTAT 351 60 This study
GFkV-2R GTCGGTGTAGGTGACGGAGTCCT
GLRaV-1 GLRaV-1-F TGGTTTCGGTACATCTGCTTATAC 841 55 This study
GLRaV-1-R CACATTACTTTTCCGCCCGAA
GLRaV-3 GLRaV-3-F ATGGCATTTGAACTGAAATTAGGG 416 55 This study
GLRaV-3-R1 ACTTTCCCTGGCTCGTTAATAAC
GRBV GVG-F1 CTCGTCGCATTTGTAAGA 557 60 Al Rwahnih et al. (2013)
GVG-R2 ACTGACAAGGCCTACTACG
GINV GBINCP1A ATGTCGATMAGRCAGGAATTG 585 55 Fan et al. (2017)
GBINCP1B CATAGTAAAAGCACCCTCGCT

Primers specific for the three viruses of GFkV, GLRaV-1, and GLRaV-3 were designed based on sequences reported in GenBank database.

GFkV: AJ309022, HQ688989, and KT000361; GLRaV-1: JQ023131, KU674797, MG925332, and MH807223; GLRaV-3: AF037268, GU983863, GQ352631, MH814482, and MK804765.

GFkV, grapevine fleck virus; GLRaV, grapevine leafroll-associated virus; GRBV, grapevine red blotch associated virus; GINV, grapevine berry inner necrosis virus.

Table 3.
RT-PCR results of five viruses by grapevine cultivars
Host Number of Viruses
Tested samples Detected samples GFkV GLRaV-1 GLRaV-3 GRBV GINV
Cambell early 41 11 (26.83a) 9 (21.95) 1 (2.44) 6 (14.63) 0 (0.00) 0 (0.00)
Chungrang 18 5 (27.78) 4 (22.22) 0 (0.00) 4 (22.22) 0 (0.00) 0 (0.00)
Shine muscat 145 119 (82.07) 108 (74.48) 3 (2.07) 99 (68.22) 0 (0.00) 0 (0.00)
Alexandria 5 3 (60.00) 2 (40.00) 0 (0.00) 3 (60.00) 0 (0.00) 0 (0.00)
Jaok 8 3 (37.50) 3 (37.50) 0 (0.00) 0 (0.00) 0 (0.00) 0 (0.00)
Total 217 141 (64.98) 126 (58.08) 4 (1.84) 112 (51.61) 0 (0.00) 0 (0.00)

RT-PCR, reverse transcription polymerase chain reaction; GFkV, grapevine fleck virus; GLRaV, grapevine leafroll-associated virus; GRBV, grapevine red blotch associated virus; GINV, grapevine berry inner necrosis virus.

a Infection rate (%).

Table 4.
RT-PCR results of five grapevine virus by the region of samples collection
Area Number of Viruses
Tested samples Detected samples GFkV GLRaV-1 GLRaV-3 GRBV GINV
Chungbuk Cheongju 28 10 (25.71a) 9 (32.14) 0 (0.00) 5 (17.86) 0 (0.00) 0 (0.00)
Okcheon 20 14 (70.00) 13 (65.00) 0 (0.00) 10 (50.00) 0 (0.00) 0 (0.00)
Yeongdong 46 23 (50.00) 20 (43.48) 1 (2.17) 19 (41.30) 0 (0.00) 0 (0.00)
Jincheon 5 4 (80.00) 4 (80.00) 0 (0.00) 2 (40.00) 0 (0.00) 0 (0.00)
subtotal 99 51 (51.52) 46 (46.46) 1 (1.01) 36 (36.36) 0 (0.00) 0 (0.00)
Gyeongbuk Gimcheon 6 5 (83.33) 5 (83.33) 0 (0.00) 3 (50.00) 0 (0.00) 0 (0.00)
Yeongcheon 91 78 (85.71) 69 (75.82) 0 (0.00) 67 (73.63) 0 (0.00) 0 (0.00)
Sangju 21 7 (33.33) 6 (28.57) 3 (14.29) 6 (28.57) 0 (0.00) 0 (0.00)
subtotal 118 90 (76.27) 80 (67.80) 3 (2.54) 76 (64.41) 0 (0.00) 0 (0.00)
Total 217 141 (64.98) 126 (58.06) 4 (1.84) 112 (51.61) 0 (0.00) 0 (0.00)

RT-PCR, reverse transcription polymerase chain reaction; GFkV, grapevine fleck virus; GLRaV, grapevine leafroll-associated virus; GRBV, grapevine red blotch associated virus; GINV, grapevine berry inner necrosis virus.

a Infection rate (%).

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by Chungbuk National University Korea National University Development Project (2021).

REFERENCES

Al Rwahnih, M., Dave, A., Anderson, M. M., Rowhani, A., Uyemoto, J. K. and Sudarshana, M. R. 2013. Association of a DNA virus with grapevines affected by red blotch disease in California. Phytopathology 103: 1069-1076.
crossref pmid
Basso, M. F., Fajardo, T. V. M. and Saldarelli, P. 2017. Grapevine virus diseases: economic impact and current advances in viral prospection and management. Rev. Bras. Frutic. 39: e-411.
crossref
Cho, I. S., Chung, B. N., Hammond, J., Moon, J. S. and Lim, H. S. 2018. First report of grapevine rupestris vein feathering virus infecting grapevines in Korea. Plant Dis. 102: 1471.
crossref
Cho, I. S., Jung, S. M., Cho, J. D., Choi, G. S. and Lim, H. S. 2013. First report of grapevine pinot gris virus infecting grapevine in Korea. New Dis. Rep. 27: 10.
crossref pdf
Cho, I. S., Yang, C. Y., Kwon, S. J., Yoon, J. Y., Kim, D. H., Choi, G. S. et al. 2019. First report of grapevine syrah virus 1 infecting grapevines in Korea. Plant Dis. 103: 2970.
crossref
Fan, X. D., Zhang, Z. P., Ren, F., Hu, G. J., Zhou, J., Li, Z. N. et al. 2017. Occurrence and genetic diversity of grapevine berry inner necrosis virus from grapevines in China. Plant Dis. 101: 144-149.
crossref pmid
Fuchs, M. 2020. Grapevine viruses: a multitude of diverse species with simple but overall poorly adopted management solutions in the vineyard. J. Plant Pathol. 102: 643-653.
crossref pdf
Jeong, S.-H., Kim, S.-H. and Heo, J.-Y. 2022. The first report of grapevine yellow speckle viroid 2 in Korea. J. Plant Pathol. 104: 891.
crossref pdf
Jo, Y., Choi, H., Song, M. K., Park, J.-S., Lee, J. W. and Cho, W. K. 2017a. First report of grapevine yellow speckle viroid 1 and Hop stunt viroid infecting grapevines (Vitis vinifera) in Korea. Plant Dis. 101: 1069.
crossref
Jo, Y., Choi, H., Song, M. K., Park, J. S., Lee, J. W. and Cho, W. K. 2018a. First report of grapevine geminivirus A in diverse Vitis species in Korea. Plant Dis. 102: 255.
crossref
Jo, Y., Song, M.-K., Choi, H., Park, J.-S., Lee, J.-W. and Cho, W. K. 2017b. First report of grapevine rupestris stem pitting-associated virus in Grapevine in Korea. Plant Dis. 101: 1068.
crossref
Jo, Y., Song, M.-K., Choi, H., Park, J.-S., Lee, J.-W., Lian, S. et al. 2017c. Genome sequence of grapevine virus T, a novel foveavirus infecting grapevine. Genome Announc. 5: e00995-17.
crossref pmid pmc pdf
Jo, Y., Song, M. K., Choi, H., Park, J. S., Lee, J. W. and Cho, W. K. 2017d. First report of grapevine fleck virus and grapevine virus E in grapevine in Korea. Plant Dis. 101: 1069.
crossref
Jo, Y., Song, M. K., Choi, H., Park, J. S., Lee, J. W. and Cho, W. K. 2017e. First report of grapevine fabavirus in diverse Vitis species in Korea. Plant Dis. 101: 1829.
crossref
Jo, Y., Song, M. K., Choi, H., Park, J. S., Lee, J. W. and Cho, W. K. 2018b. First report of grapevine virus B in grapevine in Korea. Plant Dis. 102: 1466.
crossref
Kim, H. R., Lee, S. H., Lee, H. C., Kim, Y. T. and Park, J. W. 2004. Identification of grapevine leafroll-associated virus 3 ampelovirus from grapevines in Korea. Plant Pathol. J. 20: 127-130.
crossref
Kim, J.-S., Lee, S.-H., Choi, H.-S., Kim, M.-K., Kwak, H.-R., Nam, M. et al. 2011. Occurrence of virus diseases on major crops in 2010. Res. Plant Dis. 17: 334-341. (In Korean)
crossref
Kim, S.-H. and Heo, J.-Y. 2022. First report of grapevine virus L infecting grapevine in Korea. J. Plant Pathol. 104: 819.
crossref pdf
Kim, S.-H., Jeong, S.-H. and Heo, J.-Y. 2021. Incidence of 14 grapevine viruses in Korean vineyards. Not. Bot. Horti Agrobot. Cluj-Napoca. 49: 12490.
crossref pdf
Korean Statistical Information Service (KOSIS). 2021. Status of main cultivars cultivated by outdoor grape farmers. ULR https://kosis.kr/statHtml/statHtml.do?orgId=101&tblId=DT_1ET0014&co nn_path=I2 [11 January 2024]
Krenz, B., Thompson, J. R., McLane, H. L., Fuchs, M. and Perry, K. L. 2014. Grapevine red blotch-associated virus Is Widespread in the United States. Phytopathology 104: 1232-1240.
crossref pmid
Kwak, H.-R., Yoon, J.-S., Shin, J.-C., Seo, J.-K., Kim, M., Lee, J.-K. et al. 2016. First report of blueberry leaf mottle virus on grapevine in Korea. Plant Dis. 100: 232.
crossref
Lim, S., Igori, D., Zhao, F., Moon, J. S., Cho, I.-S. and Choi, G.-S. 2016. First report of grapevine red blotch-associated virus on grapevine in Korea. Plant Dis. 100: 1957.
crossref
Martelli, G. P. 2017. An overview on grapevine viruses, viroids, and the diseases they cause. Grapevine viruses: molecular biology, diagnostics and management. Springer, Cham, Switzerland. pp. 31-46.
crossref
Myles, S., Boyko, A. R., Owens, C. L., Brown, P. J., Grassi, F., Aradhya, M. K. et al. 2011. Genetic structure and domestication history of the grape. Proc. Natl. Acad. Sci. U S A 108: 3530-3535.
crossref pmid pmc
This, P., Lacombe, T. and Thomas, M. R. 2006. Historical origins and genetic diversity of wine grapes. Trends Genet. 22: 511-519.
crossref pmid


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next