Res. Plant Dis > Volume 28(4); 2022 > Article
충남 예산 지역의 국화에서 바이러스 및 바이로이드 병들의 발생 현황

요 약

국화(Dendranthema morifolium)는 한국에서 경제적으로 중요한 화훼식물에 포함되고, 바이러스와 바이로이드 병들에 의해 경제적 피해를 받고 있다. 본 연구에서는 충청남도 예산군에서 재배된 국화 350개체를 대상으로 7종의 바이러스들과 2종의 바이로이드들(Chrysanthemum chlorotic mottle viroid, CChMVd; Chrysanthemum stunt viroid, CSVd; Cucumber mosaic virus, CMV; Chrysanthemum virus B, CVB; Chrysanthemum stem necrosis orthotospovirus, CSNV; Impatiens necrotic spot orthotospovirus, INSV; Potato virus X, PVX; Tomato aspermy virus, TAV; Tomato spotted wilt orthotospovirus, TSWV)을 검정하였다. 그 결과 2종의 바이러스들(CVB-CN-Y, TAV-CN-Y)과 2종의 바이로이드들(CChMVd-CN-Y, CSVd-CN-Y)이 검정되었다. CVB-CN-Y는 6개의 국화 식물체들에서 검정되었고, TAV-CN-Y는 한 개가 국화 식물체에서만 검정되었다. CChMVd-CN-Y는 97개의 국화 식물체들에서 검정되었으며, CSVd-CN-Y는 21개의 국화 식물체들에서 검정되었다. CVB-CN-Y는 CVB-GS1과 86.9% 염기서열 상동성을 보였으며, TAV-CN-Y는 3개의 분리주들(TAV-Chj, TAV-P, TAV-V)과 100% 염기서열이 일치하였다. CChMVd-CN-Y는 CChMVd-Horst와 99.5% 염기서열 상동성을 보였으며, CSVd-CN-Y는 4개의 분리주들(Au1.1, K4pop, Sagae, Tochigi)과 99.7% 염기서열 상동성을 보였다. 본 연구는 2021년 예산군에서 재배된 국화들을 대상으로 바이러스 및 바이로이드들을 검정하고 그들의 감염률에 관한 보고서이다.

ABSTRACT

Chrysanthemum plants are one of the most economically important plants in South Korea. Both virus and viroid can cause diseases and economic damage to the plants. In this study, we investigated the detection of seven viruses and two viroids in 350 chrysanthemum plants cultivated in Yesan-gun, Chungcheongnam-do. Two viruses, chrysanthemum virus B (CVB) and tomato aspermy virus (TAV), and two viroids, chrysanthemum chlorotic mottle viroid (CChMVd) and chrysanthemum stunt viroid (CSVd), were detected in this study. The two viruses were detected in six samples and one sample, respectively. The two viroids were detected in 97 samples and 21 samples, respectively. The nucleotide sequences of the CVB-CN-Y, TAV-CN-Y, CChMVd-CN-Y, and CSVd-CN-Y obtained in this study showed 83.7-86.9%, 99.2-100.0%, 94.4-99.5%, and 95.7-99.7% identity, respectively, compared to their other strains/isolates. The CVB-CN-Y and TAV-CN-Y showed the greatest nucleotide sequence homology to CVB-GS1 and three TAV isolates (TAV-V, TAV-P, and TAV-ChJ), respectively. The CChMVd-CN-Y and CSVd-CN-Y showed the greatest nucleotide sequence homology to CChMVd-Horst and four CSVd isolates (Au1.1, K4pop, Sagae, and Tochigi), respectively. This study is the report on the infection rate of viruses and viroids in chrysanthemum plants cultivated in Yesan-gun in 2021.

서 론

국화(Chrysanthemum morifolium)는 국화과(Asteraceae)에 속하는 다년생 초본식물로 세계에 널리 분포하고, 약 200여 품종이 보고되고 있으며, 세계 3대 절화류에 포함된다(Kim 등, 2012, 2021). 특히 한국에서 국화는 절화류 중 가장 재배면적(299 ha)이 넓고, 장미 다음으로 수출 주력 작물이다(Ministry of Agriculture, Food and Rural Affairs, 2021).
국화는 전 세계적으로 12종의 바이러스들(Chrysanthemum virus B, CVB; Chrysanthemum stem necrosis virus, CSNV; Cucumber mosaic virus, CMV; Impatiens necrotic spot orthotospovirus, INSV; Sweet potato feathery mottle virus, SPFMV; Tomato aspermy virus, TAV; Tomato leaf curl New Delhi virus, ToLCNDV; Tobacco mosaic virus, TMV; Tomato spotted wilt orthotospovirus, TSWV; Potato virus X, PVX; Potato virus Y, PVY; Zucchini yellow mosaic virus, ZYMV)과 2종의 바이로이드들(Chrysanthemum chlorotic mottle viroid, CChMVd; Chrysanthemum stunt viroid, CSVd)이 보고되었다(Ashwathappa 등, 2020; Kondo 등, 2011; Liu 등, 2014; Nassar 등, 2012; Niu 등, 2015; Song 등, 2012; Supakitthanakorn 등, 2022c; Trolinger 등, 2017; Verma 등, 2004; Zhao 등, 2015).
한국에서는 1997년에 경상남도 마산에서 잎의 황화와 기형을 나타내는 국화에서 CSVd를 첫 보고를 시작으로, 2006년에는 황화 반점 또는 병징이 없는 국화 잎에서 CChMVd가 발견되었고, 퇴록반점과 괴저가 나타난 국화에서 TSWV 감염을 확인하였다(Chung 등, 2001, 2006b, 2006c). 2013년에는 국화 잎에서 괴저 반점과 변형 및 줄기의 괴저 부분에서 CSNV를 첫 검정되었다(Yoon 등, 2017). 그 밖에 국화과에 속하는 감국(Dendranthema indicum)과 구절초(Chrysanthemum zawadskii var. latilobum)에서 각각 CVB와 TAV 복합 감염과 TAV 단독 감염을 보고하였다(Chung 등, 1999; Kwak 등, 2021). 또한 산국(Chrysanthemum boreale)에서는 CMV 염기서열을 보고하였다(NCBI accession no. AF316362).
국화에 발생하는 바이러스 및 바이로이드 병들은 주로 영양번식을 위한 삽목과 매개충(총채벌레, 진딧물 등)으로 감염되기 때문에 해충을 방제하더라도 감염된 모주로부터 삽목된 개체들이 쉽게 감염될 수 있어 조기 검정을 통한 무병묘 선발이 매우 중요하다(Lewis, 1997; Yoon 등, 2020).
본 연구는 충청남도 예산 지역의 무병묘 생산을 위한 조직배양묘들을 대상으로 7종의 바이러스들과 2종의 바이로이드들을 검정하여 감염률을 분석하고, 검정된 바이러스들과 바이로이드들의 염기서열들을 기초하여 계통학적 분석을 수행하였다.

재료 및 방법

실험재료

2021년 충청남도 예산군 국화 시설 재배지에서 성체로 성장 중인 350개 조직배양묘들을 무작위로 수집하였다. 여기서 수집된 350개 조직배양묘들은 5곳의 시설 재배지에서 각 70씩 수집하였다. 수집된 국화의 일부 잎들은 병징이 나타나지 않거나, 황화 또는 부분적 괴사 병징이 관찰되었다.

핵산 추출

핵산 추출을 위해 1.5 ml 튜브에 100 mg 국화 잎과 300 μ l RNA extraction buffer (50 mM Tris-Cl, pH 8.0; 10 mM ethylenediaminetetraacetic acid, pH 8.0; 0.1% sodium dodecyl sulfate; 0.1% betamercaptoethanol)를 넣고, 호모게나이저를 사용하여 간다. 그 후, phenol/chloroform 방법을 사용하여 total RNA를 추출하였다(Liu 등, 1998). 추출된 total RNA의 순도는 분광광도계(NanoDrop One, Thermo Fisher Scientific, Waltham, MA, USA)를 사용하여 260 nm/280 nm 흡광도 값이 2.0에 가깝게 분석되었다.

프라이머 제작

7종의 국화 감염 바이러스들(CMV, CVB, CSNV, INSV, PVX, TAV, TSWV)과 2종의 바이로이드들(CChMVd, CSVd)을 검정하기 위해 CMV와 TSWV를 제외한 나머지 프라이머들을 제작하였다. 프라이머를 제작하기 위해 미국 국립생물공학정보센터(National Center for Biotechnology Information, NCBI)에 선행 보고된 염기서열들을 확보하였다. 확보된 5종의 바이러스들과 2종의 바이로이드들의 염기서열들을 각각 DNAMAN software (Lynnon Biosoft, Vaudreuil, Canada)를 사용하여 multiple alignment를 분석한 후, 가장 상동성 높은 염기서열 부위를 탐색하여 프라이머를 제작하였다(Table 1). CMV 와 TSWV 프라이머들은 선행 연구에서 제작된 프라이머들을 사용하였다(Song 등, 2016).
Table 1.
Primers used for PCR detection of viruses and viroids in this study
Virus Primer name Sequences (5′ → 3′) Amplicon size (bp)
CChMVd CChMVd full UP GGCACCTGACGTCGGTG 399
CChMVd full DN GACCTCTTGGGGGTTTCAAA
CSVd CSVd full UP CGGGACTTACTTGTGGTT 354
CSVd full DN AGGGAACAAAACTAAGGTTC
CMV CMV 650 UP ATGGACAAATCTGAATCAACC 650
CMV 650 UP TCAGACTGGGAGCACTCCAGA
CVB CVB 6952 UP CTGATGCCTCTTACACCT 547
CVB 7498 DN TAACGATCTAACCACTCAC
CSNV CSNV CP 39 F GAACTCCAAACATCTCATAGA 632
CSNV CP 680 R CAATGATAACCTGGATCAGATC
INSV INSV CP 25 F ATCAATAGTAGCATTAAACATGCT 768
INSV CP 789 R ATGAACAAAGCAAAGATTACCAAG
PVX PVX CP UP ACCAGCTAGCACAACACA 626
PVX CP DN TGGCAAAGTCGTTGGATT
TAV TAV CP UP ATGGCCCAAAACGGTACG 657
TAV CP DN TCACACCGGGAGCGTTG
TSWV TSWV CP UP TTAAGCAAGTTCTGTGAGTTTTGC 777
TSWV CP DN ATGTCTAAGGTTAAGCTCACTAA

PCR, polymerase chain reaction; CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid; CMV, cucumber mosaic virus; CVB, chrysanthemum virus B; CSNV, chrysanthemum stem necrosis virus; INSV, impatiens necrotic spot orthotospovirus; PVX, potato virus X; TAV, tomato aspermy virus; TSWV, tomato spotted wilt orthotospovirus.

Reverse transcription polymerase chain reaction 분석

cDNA 합성을 위한 reverse transcription 반응은 1 ㎍ total RNA, 1× buffer (Thermo Fisher Scientific), 0.5 μ l random hexamer primers (Qiagen, Hilden, Germany), 1 μ l dNTPs (2.5 mM), 100 U RevertAid reverse transcriptase (Thermo Fisher Scientific)를 polymerase chain reaction (PCR) 튜브에 최종 50 μ l 맞춰 혼합한 후, 42 o C에서 60분, 70 o C에서 10분 수행하였다. 합성된 cDNA를 사용하여 다음과 같은 조건으로 PCR를 수행하였다. PCR 튜브에 5 μ l cDNA, 1× buffer (TaKaRa, Tokyo, Japan), 5 U Taq DNA polymerase (TaKaRa), 1 μ l of dNTPs (2.5 mM)와 제작된 프라이머 쌍을 넣고 최종 50 μ l 맞춰 혼합한 후, 95 o C에서 3분간 초기 변성을 하고 95 o C 30초, 54-58 o C에서 1분, 72 o C에서 1분을 30회 반복한 다음 마지막으로 72 o C에서 10분 동안 반응시켰다. PCR 산물들은 1% 아가로오즈 겔을 이용하여 0.5× TAE 용액에서 135 V로 18분 동안 전기영동을 수행한 후, UV transilluminator (Bio-Rad, Hercules, CA, USA)를 사용하여 결과를 확인하였다.

염기서열 분석

전기영동을 통해 확인된 양성 시료들을 대상으로 pGem T-easy vector system (Promega, Madison, WI, USA)를 이용하여 클로닝을 수행하였다. 삽입된 PCR 산물은 EcoRI 제한효소(Takara, Kyoto, Japan)를 사용하여 처리한 후, 아가로즈 겔 전기영동으로 크기를 확인하였다. 선발된 클론들은 염기서열을 확보하고, NCBI에서 Blast하여 확인하였다. 확인된 염기서열들은 DNAMAN software (Lynnon Biosoft)와 La-sergene software (DNASTAR, Madison, WI, USA)를 사용하여 선행 보고된 염기서열들과의 계통 분석을 수행하였다.

결 과

국화 시설재배지에서 검정된 바이러스의 감염률 조사

수집된 국화 350개의 샘플들에서 reverse transcription polymerase chain reaction (RT-PCR)과 염기서열 분석을 통해 2종의 바이러스들(CVB, TAV)과 2종의 바이로이드들(CChMVd, CSVd)이 검정되었고, 나머지 바이러스들은 양성대조군만 검정되었다(Table 2). CVB는 350개 샘플 중에서 6개체에서 검정되었으며, TAV는 350개 샘플 중에서 1개체가 검정되었다. CChMVd 는 350개 샘플 중에서 97개체가 검정되었으며, CSVd는 350개 샘플 중에서 21개체에서 검정되었다. CVB가 검정된 6개체 중에서 3개체는 단독 감염이고, 나머지 3개체는 CChMVd에 복합 감염으로 분석되었다. TAV가 검정된 한 개체는 CChMVd도 함께 검정되었다. CChMVd가 검정된 97개체 중 80개체는 단독 감염이었고, 나머지 17개체는 복합 감염이었다. CSVd가 검정된 21개체 중 10개체들은 단독 감염이었고, 나머지 11개체는 복합 감염으로 모두 CChMVd와 함께 감염되었음을 확인하였다. 여러 개체에서 검정된 CVB, CChMVd, CSVd들의 염기서열들은 각각 99.99-100.00% 상동성을 보였고, 여기서 검정된 바이러스들과 바이로이드들을 ‘ CN-Y’ 분리주라 하였다.
Table 2.
The infection rate of viruses and viroids in 350 chrysanthemum plants
No. Virus name Infection rate (%) Rate of single infection (%) Rate of mixed infection (%)
1 Chrysanthemum chlorotic mottle viriod 97/350 (27.71) 80/97 (82.47) 17/97 (17.52)
2 Chrysanthemum stunt viriod 21/350 (6.00)0 10/21 (47.61) 11/21 (52.38)
3 Cucumber mosaic virus 0/350 (0.00) 000 000
4 Chrysanthemum virus B 6/350 (1.71) 003/6 (50.00) 003/6 (50.00)
5 Chrysanthemum necrosis virus 0/350 (0.00) 000 000
6 Impatiens necrotic spot virus 0/350 (0.00) 000 000
7 Potato virus X 0/350 (0.00) 000 000
8 Tomato aspermy virus 1/350 (0.29) 000 0001/1 (100.00)
9 Tomato spotted wilt virus 0/350 (0.00) 000 000

검정된 2 종의 바이러스들의 염기서열 계통 분석

수집된 국화 샘플들에서 검정된 CVB-CN-Y (GenBank accession no. OL827561)와 TAV (GenBank accession no. OP820435)의 염기서열들을 대상으로 선행 보고된 CVB isolates/strains과 TAV isolates/strains의 염기서열들 사이의 상동성과 계통학적 분석을 수행하였다. CVB-CN-Y의 6,952-7,498 nucleotides (nt) 부위 염기서열들은 러시아에서 분리된 CVB-GS1 (GenBank accession no. MZ514908)와 86.9%로 가장 높은 상동성을 보였고, 그 뒤로 인도에서 분리된 CVB-Tamil Nadu (GenBank accession no. AM765839)와 85.0%의 상동성을 보였다(Supplementary Table 1). CVB isolates/strains들의 계통학적 분석에서는 크게 세 개의 계통 그룹으로 분류될 수 있으며, 여기서 보고된 CVB-CN-Y는 첫 번째 계통 그룹에 포함되었다(Fig. 1A).
Fig. 1.
Phylogenetic tree analysis of two viruses and their other isolates/strains based on nucleotide sequences. (A) Phylogenetic relationship of CVB-CN-Y and other CVB isolates/strains based on the comparison of the partial nucleotide (nt) sequences (6,952-7,498 nt) of CVB genome. (B) Phylogenetic relationship of TAV-CN-Y and other TAV isolates/strains based on the comparison of coat protein (CP). Phylogenetic trees were generated using the DNAMAN package as described by Kwon et al. (2020). CVB, chrysanthemum virus B; TAV, tomato aspermy virus.
RPD-2022-28-4-237f1.jpg
TAV-CN-Y의 외피단백질 전체부위는 선행 보고된 TAV isolates/strains의 외피 단백지질 전체부위 염기서열들과 99.2-100.0% 상동성을 보였다(Supplementary Table 2). 특히 TAV-CN-Y의 외피단백질 전체부위의 염기서열은 호주의 국화에서 분리된 TAV-V (GenBank accession no. NC_003836), 헝가리의 고추에서 분리된 TAV-P (GenBank accession no. L15335), 일본의 국화에서 분리된 TAV-ChJ (GenBank accession no. LC634033)에서 모두 100% 상동성을 보였다. TAV isolates/strains의 계통학적 분석에서는 계통 그룹이 크게 나눠지지 않았다(Fig. 1B).

검정된 2 종의 바이로이드들의 염기서열 계통 분석

수집된 국화 샘플들에서 검정된 CChMVd-CN-Y (GenBank accession no. OL827561)와 CSVd-CN-Y (GenBank accession no. OL827563)의 전체염기서열들을 대상으로 선행 보고된 CChMVd isolates/strains과 CChMVd isolates/strains의 염기서열들 사이의 상동성과 계통학적 분석을 수행하였다. CChMVd-CN-Y 는 선행 보고된 CChMVd isolates/strains 염기서열들과 94.4-99.5% 상동성을 나타냈으며, 스페인에서 보고된 CChMVd-Horst (GenBank accession no. NC_003540)와 99.5% 상동성으로 가장 높게 분석되었다(Supplementary Table 3). CChMVd isolate/strains들은 계통학적 분석에서는 크게 세개의 계통그룹으로 분류될 수 있으며, 여기서 보고된 CChMVd-CN-Y는 첫번째 계통그룹에 포함되고 스페인에서 보고된 CChMVd-Horst 와 근연관계가 가장 높게 나타났다(Fig. 2A).
Fig. 2.
Phylogenetic tree analysis of two viroids and their other isolates/strains based on nucleotide sequences. (A) Phylogenetic relationship of CChMVd-CN-Y and other CChMVd-CN-Y isolates/strains based on the comparison of full-genome nucleotide sequences. (B) Phylogenetic relationship of CSVd-CN-Y and other CSVd isolate/strains based on the comparison of full-genome nucleotide sequences. Phylogenetic trees were generated using the DNAMAN package as described by Kwon et al. (2020). CChMVd, chrysanthemum chlorotic mottle viroid; CSVd, chrysanthemum stunt viroid.
RPD-2022-28-4-237f2.jpg
CSVd-CN-Y는 선행 보고된 CSVd isolates/strains의 염기서열들과 95.7-99.7% 상동성을 보여주었다. CSVd-CN-Y는 일본에서 분리된 CSVd-Tochigi (GenBank accession no. AB006737)와 CSVd-Sagae (GenBank accession no. D88895), 한국에서 분리된 CSVd-K4pop (GenBank accession no. LC088323), 호주에서 분리된 CSVd-AU1.1 (GenBank accession no. JQ809252)에서 모두 99.7% 상동성으로 가장 높게 분석되었다(Supplementary Table 4). CSVd isolate/strains들은 계통학적 분석에서 크게 세 개의 계통 그룹으로 분류될 수 있으며, 여기서 보고된 CSVd-CN-Y는 첫 번째 계통 그룹에 포함되고 일본에서 분리된 CSVd-Tochigi와 근연관계가 가장 높게 나타났다(Fig. 2B).

고 찰

한국에서 재배되고 있는 국화는 1997년 CSVd 감염 보고를 시작으로 국화 재배지에 지속적으로 바이러스 및 바이로이드 병들이 보고되고 있다(Chung과 Pak, 2008; Chung 등, 2001, 2005, 2006a, 2006b, 2006c). 이러한 국화 바이러스 및 바이로이드 병들을 방제하기 위해 주로 화학적 요법(chemotherapy), 열처리 요법(thermotherapy), 정단 분열 조직배양(meristem tip culture) 방법 등을 단독 또는 혼합하여 사용한다(Kumar 등, 2009; Ram 등, 2005, 2009). 또한 바이러스를 매개하는 해충들의 방제에도 힘쓰고 있다(Gupta 등, 2021; Khan 등, 2021).
그러나 본 연구의 결과를 통해 국화 무병묘 생산을 위한 재배지에서 바이러스 및 바이로이드 병들에 대한 예방 및 방제가 완벽하지 않음을 보여주고 있다. 여기서 검정된 2종의 바이러스들(CVB, TAV)과 2종의 바이로이드들(CChMVd, CSVd)은 모두 감염된 즙액과 삽목으로 전염될 수 있으며, 특히 CChMVd와 CSVd는 종자에 의해 CVB와 TAV는 진딧물에 의해 전염될 수 있다(Cho 등, 2013; Chung과 Pak, 2008; Ebata 등, 2019; Ohkawa 등, 2007; Verma 등, 2009). 따라서 여기서 검정된 바이러스들과 바이로이드들은 국화 번식을 위한 삽목과 재배지에서의 매개충 의한 전염으로 예측될 수 있다. 특히 여러 개체에서 검정된 바이러스(CVB)와 바이로이드들(CChMVd, CSVd)의 염기서열 변이율이 낮은 것으로 판단할 때, 감염된 원원종 또는 원종에 의한 계대전염 결과로 보인다.
본 연구에서 검정된 CChMVd-CN-Y와 CSVd-CN-Y의 계통학적 분석에서 그들은 선행 보고된 국내 다른 분리주들과 함께 근연관계를 나타내지 않고, 다른 국외 분리주와 근연관계를 나타내는 것으로 분석되었다. 선행 연구된 CChMVd 분리주들은 아시아 지역에서 분리된 계통과 비아시아 지역에서 분리된 계통으로 구분되었고, 국내에서 분리된 계통들도 아시아 지역에서 분리된 계통들과 근연관계를 보였다(Supakittahanakorn 등, 2022b). 그러나 여기서 분리된 CSVd-CN-Y는 스페인에서 분리된 분리주와 근연관계를 보였다. 따라서 본 연구에서 분리된 CChMVd-CN-Y와 CSVd-CN-Y는 선행 보고된 국내 분리주들과 다른 계통으로 분석되며, 그 차이는 무병묘 생산으로 위해 사용된 원원종 및 원종 또는 매개충의 다름에 있을 것으로 예측된다.
국화 무병묘 생산은 감염된 모주들의 조기 검정을 통한 무병묘 선발과 삽목 도구의 소독 및 매개충 발생에 대한 예찰과 방제가 매우 중요하다. 그 중, 무병묘 선발에서는 조기 검정할 수 있는 정밀진단기술 개발이 중요하며, 현재 국화 감염 바이러스 및 바이로이드 병들 중 일부는 정밀 진단하기 위해 real-time PCR 또는 loop-mediated isothermal amplification 등이 개발되었다(Guan 등, 2017; Kim 등, 2015; Supakitthanakorn 등, 2022a). 본 연구에서는 RT-PCR 분석을 통해 바이러스들과 바이로이드들의 발생 현황을 조사하였으나, 무병묘 생산을 위한 원원종 및 원종 선발과 조직배양 안에서의 무병묘 선발을 위해서는 검정의 민감도가 높은 정밀진단기술 적용이 요구된다.
본 연구는 주요 감염되는 국화 바이러스 및 바이로이드 병들에 대한 정보와 그들을 검정하는 데 사용할 수 있는 프라이머 정보들을 제공하고, 국내 국화 바이러스 및 바이로이드 병들의 염기서열들을 제공함으로써 더욱 정밀한 진단기술 개발에 도움을 줄 수 있다.

NOTES

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This study was supported by the Korea Institute of Plan-ning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Crop Viruses and Pests Response Industry Technology Development Program, funded by the Ministry of Agriculture, Food, and Rural Affairs (MAFRA) (grant number 120084-3). This study was also supported by a sabbatical year research grant from Seoul Women's University (2021). Yoon Hyun Bang and Eun Gyeong Song contrib-uted equally to this study and should be considered as co-first authors.

Electronic Supplementary Material

Supplementary materials are available at Research in Plant Disease website (http://www.online-rpd.org/).

References

Ashwathappa, K. V., Venkataravanappa, V., Reddy, C. N. and Reddy, M. K. 2020. Association of Tomato leaf curl New Delhi virus with mosaic and leaf curl disease of chrysanthemum and its whitefly cryptic species. Indian Phytopathol. 73: 533-542.
crossref pdf
Cho, W. K., Jo, Y., Jo, K.-M. and Kim, K.-H. 2013. A current overview of two viroids that infect chrysanthemums: chrysanthemum strunt viroid and chrysanthemum chlorotic mottle viroid. Viruses 5: 1099-1113.
crossref pmid pmc
Chung, B. N., Choi, G. S. and Choi, Y. M. 1999. Identification of tomato aspermy virus (TAV) and chrysanthemum virus B (CVB) from Dendranthema indicum in Korea. Plant Pathol. J. 15: 119-123.
Chung, B. N., Choi, G. S., Kim, H. R. and Kim, J. S. 2001. Chrysanthemum stunt viroid in Dendranthema grandiflorum. Plant Pathol. J. 17: 194-200.
Chung, B. N., Huh, E. J. and Kim, J. S. 2006a. Effect of temperature on the concentration of chrysanthemum stunt viroid in CSVd-infected chrysanthemum. Plant Pathol. J. 22: 152-154.
crossref
Chung, B. N., Kim, D. C., Kim, J. S. and Cho, J. D. 2006b. Occurrence of chrysanthemum chlorotic mottle viroid in chrysanthemum (Dendranthema grandiflorum) in Korea. Plant Pathol. J. 22: 334-338.
crossref
Chung, B. N., Lim, J. H., Choi, S. Y., Kim, J. S. and Lee, E. J. 2005. Occurrence of chrysanthemum stunt viroid in chrysanthemum in Korea. Plant Pathol. J. 21: 377-382.
crossref
Chung, B. N. and Pak, H. S. 2008. Seed transmission of Chrysanthemum stunt viroid in chrysanthemum. Plant Pathol. J. 24: 31-35.
crossref
Chung, B. N., Pak, H. S., Jung, J. A. and Kim, J. S. 2006c. Occurrence of tomato spotted wilt virus in chrysanthemum (Dendranthema grandiflorum) in Korea. Plant Pathol. J. 22: 230-234.
crossref
Ebata, M., Matsushita, Y., Morimoto, M. and Mochizuki, T. 2019. Distribution of chrysanthemum chlorotic mottle viroid in shoot meristem and flower buds of chrysanthemum. Eur. J. Plant Pathol. 154: 555-563.
crossref pdf
Guan, Z., Wu, D., Song, A., Chen, F., Chen, S. and Fang, W. 2017. A highly sensitive method for the detection of chrysanthemum virus B. Electron. J. Biotechnol. 26: 64-68.
crossref
Gupta, R., Gupta, A., Jain, S., Singh, D. and Verma, N. 2021. Chrysanthemum production, viral diseases and their management. In: Virus Diseases of Ornamental Plants: Characterization, Identification, Diagnosis and Management, eds. by S. K. Raj, R. K. Gaur and Z. Yin, pp. 261-275. Springer, Singapore.
crossref
Khan, A. U., Choudhury, M. A. R., Khan, A. U., Khanal, S. and Mau-keeb, A. R. M. 2021. Chrysanthemum production in Bangladesh: significance the insect pests and disease management: a review. J. Multidiscip. Appl. Nat. Sci. 1: 25-35.
crossref pdf
Kim, B. M., Kim, S. Y. and Lim, J. H. 2021. Analysis of domestic and overseas marketability for revitalization of exports of cut flowers and Chrysanthemums produced in Korea. Flower Res. J. 29: 29-41.
crossref
Kim, S. J., Lee, S. K. and Kim, K. S. 2012. Current research trend of postharvest technology for chrysanthemum. Korean J. Plant Res. 25: 156-168.
crossref
Kim, W.-S., Haj-Ahmad, Y., Stobbs, L.W. and Greig, N. 2015. Evaluation of viroid extraction methods and application of a one-step reverse transcription real-time polymerase chain reaction assay (RT-qPCR) for the rapid detection of chrysanthemum stunt viroid (CSVd) infection. Can. J. Plant Pathol. 37: 221-229.
crossref
Kondo, T., Yamashita, K. and Sugiyama, S. 2011. First report of impatiens necrotic spot virus infecting chrysanthemum (Chrysanthemum morifolium) in Japan. J. Gen. Plant Pathol. 77: 263-265.
crossref pdf
Kumar, S., Khan, M. S., Raj, S. K. and Sharma, A. K. 2009. Elimination of mixed infection of cucumber mosaic and tomato aspermy virus from Chrysanthemum morifolium Ramat. cv. Pooja by shoot meristem culture. Sci. Hortic. 119: 108-112.
crossref
Kwak, H.-R., Kim, J.-G., Kim, J.-E., Byun, H.-S., Choi, H.-S., Wintermantel, W. M. et al. 2021. First report of tomato aspermy virus in Chrysanthemum zawadskii var. latilobum in Korea. J. Plant Pathol. 103: 1005-1006.
crossref pdf
Kwon, Y. E., Song, E. G., Choi, S. H. and Ryu, K. H. 2020. Genetic differences between Korean and American isolates of petunia vein clearing virus. Virus Genes 56: 78-86.
crossref pmid pdf
Lewis, T. 1997. Pest thrips in perspective. In: Thrips as Crop Pests, ed. by T. Lewis, pp. 1-13. CAB International, Wallingford, UK.
Liu, J.-J., Goh, C.-J., Loh, C.-S., Liu, P. and Pua, E.-C. 1998. A method for isolation of total RNA from fruit tissue of banana. Plant Mol. Biol. Rep. 16: 87.
Liu, X. L., Wei, Q., Hong, B. and Zhao, X. T. 2014. First report of potato virus Y strain N-Wilga infecting chrysanthemum in China. Plant Dis. 98: 1589.
crossref
Ministry of Agriculture, Food and Rural Affairs. 2021. Annual Report of Floriculture. MAFRA Press, Sejong, Korea. 17 pp.
Nassar, E. A., El-Dougdoug, K. A., Osman, M. E., Dawoud, R. A. and Kinawy, A. H. 2012. Characterization and elimination of a TMV isolate infecting Chrysanthemum plants in Egypt. Int. J. Virol. 8: 14-26.
crossref
Niu, E. B., Chen, L. J. and Niu, Y. B. 2015. First report of zucchini yellow mosaic virus in chrysanthemum. Plant Dis. 99: 1289.
crossref
Ohkawa, A., Yamada, M., Sayama, H., Sugiyama, N., Okuda, S. and Natsuaki, T. 2007. Complete nucleotide sequence of a Japanese isolate of chrysanthemum virus B (genus Carlavirus). Arch. Virol. 152: 2253-2258.
crossref pmid pdf
Ram, R., Verma, N., Singh, A. K., Singh, L., Hallan, V. and Zaidi, A. A. 2005. Indexing and production of virus-free chrysanthemums. Biol. Plant. 49: 149-152.
crossref
Ram, R., Verma, N., Singh, A. K. and Zaidi, A. A. 2009. Virus-free Chrysanthemum: production and quality management. Arch. Phytopathol. Plant Prot. 42: 940-949.
Song, A., You, Y., Chen, F., Li, P., Jiang, J. and Chen, S. 2012. A multiplex RT-PCR for rapid and simultaneous detection of viruses and viroids in chrysanthemum. Lett. Appl. Microbiol. 56: 8-13.
crossref pmid pdf
Song, E. G., Lee, H. S. and Ryu, K. H. 2016. Occurrence of hydrangea ringspot virus and hydrangea chlorotic mottle virus in hydrangea plants in South Korea. J. Gen. Plant Pathol. 82: 281-285.
crossref pdf
Supakitthanakorn, S., Vichittragoontavorn, K., Kunasakdakul, K. and Ruangwong, O.-U. 2022a. Development of the colorimetric loop-mediated isothermal amplification technique for rapid and sensitive detection of chrysanthemum stunt viroid in Chrysanthemum. J. Plant Prot. Res. 62: 272-280.
Supakitthanakorn, S., Vichittragoontavorn, K., Kunasakdakul, K. and Ruangwong, O.-U. 2022b. Phylogenetic analysis and molecular characterization of chrysanthemum chlorotic mottle viroid and chrysanthemum stunt viroid from chrysanthemum in Thailand. J. Phytopathol. 170: 700-710.
crossref pdf
Supakitthanakorn, S., Vichittragoontavorn, K., Sunpapao, A., Kunasakdakul, K., Thapanapongworakul, P. and Ruangwong, O.-U. 2022c. Tobacco mosaic virus infection of chrysanthemums in Thailand: development of colorimetric reverse-transcription loop-mediated isothermal amplification (RT-LAMP) technique for sensitive and rapid detection. Plants 11: 1788.
crossref pmid pmc
Trolinger, J. C., McGovern, R. J., Elmer, W. H., Rechcigl, N. A. and Shoemaker, C. M. 2017. Diseases of chrysanthemum. In: Hand-book of Florists’ Crops Diseases, eds. by R. J. McGovern and W. H. Elmwe, pp. 1-66. Springer International Publishing AG, New York, USA.
crossref
Yoon, J. Y., Choi, G. S. and Choi, S. K. 2017. First report of Chrysanthemum stem necrotic virus on Chrysanthemum morifolium in Korea. Plant Dis. 101: 264.
Yoon, J.-Y., Yoon, J.-B., Seo, M.-H., Choi, S.-K., Cho, I.-S., Chung, B.-N. et al. 2020. Application of multiplex RT-PCR for simultaneous identification of tomato spotted wilt virus and thrips species in an individual thrips on chrysanthemum. Res. Plant Dis. 26: 264-271. (in Korean)
crossref pdf
Verma, N., Kumar, K., Kulshrestha, S., Raikhy, G., Hallan, V., Ram, R. et al. 2009. Molecular studies on tomato aspermy virus isolates infecting chrysanthemums. Arch. Phytopathol. Plant Prot. 42: 99-111.
crossref
Verma, N., Ram, R., Hallan, V., Kumar, K. and Zaidi, A. A. 2004. Production of cucumber mosaic virus-free chrysanthemums by meristem tip culture. Crop Prot. 23: 469-473.
crossref
Zhao, X., Liu, X., Ge, B., Li, M. and Hong, B. 2015. A multiplex RT-PCR for simultaneous detection and identification of five viruses and two viroids infecting chrysanthemum. Arch Virol. 160: 1145-1152.
crossref pmid pdf


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
Rm,904 (New Bldg.) The Korean Science & Technology Center 22, Teheran-ro 7-gil, Gangnam-gu, Seoul 06130, Korea
Tel: +82-2-557-9360    Fax: +82-2-557-9361    E-mail: paper@kspp.org                

Copyright © 2026 by The Korean Society of Plant Pathology.

Developed in M2PI

Close layer
prev next