Nested PCR 기법을 이용한 토양으로부터 Barley yellow mosaic virus 검출

Detection of Barley yellow mosaic virus from Soil Using Nested PCR

Article information

Res. Plant Dis. 2017;23(1):65-68
Publication date (electronic) : 2017 March 31
doi : https://doi.org/10.5423/RPD.2017.23.1.65
이중환1,, 손창기1, 권중배1, 남효훈1, 김영태1, 이봉춘2, 신동범3
1 경상북도농업기술원 생물자원연구소
1 Institute for Bioresources Research, Gyeongsangbuk-do Agricultural Research & Extension Services, Andong 36614, Korea
2 농촌진흥청 국립식량과학원 작물기초기반과
2 Crop Foundation Division, National Institute of Crop Science, Rural Development Administration, Wanju 55365, Korea
3 농촌진흥청 국립식량과학원 재배환경과
3 Crop Cultivation and Environment Research Division, National Institute of Crop Science, Rural Development Administration, Suwon 16616, Korea
* Corresponding author Tel: +82-54-859-5123 Fax: +82-54-859-7212 E-mail: ljh8888@korea.kr
Received 2016 October 31; Revised 2017 February 07; Accepted 2017 February 14.

Abstract

Barley yellow mosaic virus (BaYMV), which is transmitted by the root-inhabiting protist Polymyxa graminis, causes a soil-borne disease. In this study, we detected BaYMV from soil using two-step nested polymerase chain reaction (PCR). Specific primers based on a coat protein region of BaYMV segment RNA1 were used in the first round of amplification. Based on the sequenced amplicon, an inner primer was designed for the second round of amplification. A PCR product of 372 bp exhibited 98%–100% nucleotide sequence identity with the coat protein region of BaYMV segment RNA1. In this study, we propose an easy method for the detection of BaYMV from soil, may considerably assist in accurate fungus-transmitted virus diagnosis and subsequent disease forecasting. This is the first report on the detection of BaYMV from soil.

서론

보리누른모자이크바이러스병(Barley yellow mosaic virus, BaYMV)은 1940년 일본에서 최초로 보고되었으며, 유럽에서 큰 피해를 일으키는 것으로 알려져 왔다(Park 등, 2004). 국내에서는 1990년대 발생이 보고되어 남부 보리 재배지를 중심으로 문제시되고 있다(Park 등, 2010). 이 바이러스는 토양전염성 바이러스로 활물 기생균 Polymyxa graminis에 의해 매개되며(Adams 등, 1986) 감염 시 40%–100%의 수량을 감소시키면서 보리에 심각한 피해를 입히고 있다(Park 등, 2010). BaYMV는 분절게놈으로 구성되어 있으며 직경 13 nm, 길이 7.3–7.6 kb의 RNA1과 3.5–3.7 kb의 RNA2로 나누어진다(Li와 Shirako, 2015). RNA 구조를 분석한 결과 국내에는 4종의 strain이 존재하는 것으로 보고되고 있다(Park 등, 2007). BaYMV는 P. graminis 휴면포자에 존재하며 휴면포자가 발아한 유주자에 의하여 전파되어 기주체의 세포질로 이동하고 전신감염을 일으키며 병징을 나타낸다(You와 Shirako, 2013). BaYMV를 매개하는 P. graminis는 인공배양이 되지 않는 활물 기생균으로 토양 중에서 휴면포자 형태로 존재하기 때문에 검출이 어려워 주로 현미경 검경에 의존하여 왔으나, 최근 polymerase chain reaction (PCR)에 의한 검출과 정량화가 가능해졌다(Cox 등, 2014). P. graminis 유주자를 통해 기주체 조직 내에 도입된 BaYMV와 토양에서 PCR을 이용하여 P. graminis를 검출한 보고는 있으나(Bae 등, 2015; Cox 등, 2014; Ketta 등, 2011), P. graminis 휴면포자에 존재하는 BaYMV를 토양에서 직접 검출한 보고는 아직 없다. 본 연구는 토양 중에서 BaYMV를 직접 검출한 최초의 보고로서 토양 내에서 BaYMV의 정밀한 진단으로 보리 바이러스병 발생예찰에 필요한 자료와 바이러스 매개균에 존재하는 바이러스 진단에 유용한 방법을 제시하였다.

본론

Total RNA 추출 및 cDNA합성

보리 재배 밭토양 및 벼 재배 논토양 150 mg에서 kit (easy-spin; INtRON, Seongnam, Korea)를 이용하여 total RNA를 분리하고 6 oligomer 랜덤 프라이머(TOPscript RT dryMIX; Enzynomics, Daejeon, Korea)를 이용하여 cDNA를 합성하였다. 대조구로 BaYMV가 검출된 보리 뿌리를 사용하였다.

Nested PCR

GenBank에 등록된 BaYMV의 coat protein 영역으로부터 제작된 BaYMV575 프라이머 조합(Table 1) 10 pmol과 토양으로부터 추출된 RNA에서 합성된 cDNA 1 탅를 사용하여 94°C/30초, 47°C/30초, 72°C/1분의 반응 조건으로 35회 반복 1차 PCR을 실시하였다. 1차 PCR에서 확보한 PCR 산물 1 μl탅를 주형으로 사용하고 primary PCR 산물의 내부서열 정보를 근거로 작성된 BaYMV372 프라이머 조합(Table 1) 10 pmol과 94°C/30초, 57°C/30초, 72°C/1분의 반응조건으로 35회 2차 PCR을 수행한 후 1.5% agarose gel에 전기영동하여 예상되는 크기의 밴드 형성 유무를 확인하였다.

Primers used for nested PCR on Barley yellow mosaic virus (BaYMV) from soil

BaYMV 검정

일반 PCR 방법으로는 토양 내의 매개균체에 존재하는 BaYMV 단편이 검출되지 않기 때문에 Fig. 1과 같이 디자인된 nested PCR 방법을 적용하여 BaYMV를 검정하였다. 보리 재배 밭토양 및 벼 재배 논토양 시료로 1차 PCR을 한 결과 밴드는 전혀 형성되지 않았으나, 2차로 수행한 PCR에서 보리 재배 및 벼 재배 토양에서 BaYMV가 감염이 확인된 보리 대조구와 동일한 크기인 372 bp의 밴드를 검출할 수 있었다(Fig. 2). 검출된 밴드를 절단하고 gel 추출 과정을 거쳐 증폭된 cDNA를 direct sequencing한 후 염기서열 상동성을 분석한 결과 기존에 보고된 BaYMV의 segment RNA1 (accession no. AB920780)의 외피단백질 영역과 98%–100% 일치하여 검출된 단편이 BaYMV임을 확인하였다. 1차 PCR에 사용한 BaYMV575 프라이머 조합은 이병 보리 조직 내에서 바이러스 검출에 이용되는 특이 프라이머였으나, 토양 시료에서 밴드가 형성되지 않는 것은 목표 바이러스 핵산의 농도가 극히 낮아 프라이머와의 농도 비율이 적정하지 않았던 것으로 추정된다. P. graminis는 보리, 귀리, 벼, 사탕수수, 밀 등과 같은 화본과 작물의 뿌리를 감염(Ketta 등, 2012)시키기 때문에 벼 재배 토양에도 P. graminis가 존재할 수 있으며, 벼 재배 토양 시료에서 BaYMV가 검출된 것은 이 바이러스를 매개하는 P. graminis가 BaYMV에 감염된 결과로 추정된다. 이상의 결과들은 보리에 누른모자이크바이러스병을 일으키는 BaYMV를 토양에서 직접 검출한 최초의 보고이며, 보리 바이러스병의 효과적인 관리를 위하여 앞으로 매개균인 P. graminis와 BaYMV 상호작용 및 바이러스 정량분석 등의 정밀한 연구가 진행되어야 할 것이다.

Fig. 1

Nested PCR scheme for detection of Barley yellow mosaic virus (BaYMV) from soil sample.

Fig. 2

Nested PCR for Barley yellow mosaic virus (BaYMV) from soil samples. (A) Primary PCR. (B) Secondary PCR. Lane M, DNA 100 bp ladder; lanes 1–5, soil samples from barley field; lanes 6–10, soil samples from rice paddy field; P, positive; N, negative control.

요약

2단계의 nested PCR 방법을 이용하여 보리 및 벼 재배토양에서 Barley yellow mosaic virus (BaYMV)를 검출하였다. BaYMV 분절 RNA1 외피단백질 영역의 특이 프라이머로 1차 PCR을 하고 내부서열로부터 작성된 프라이머로 2차 PCR을 실시하여 확보된 372 bp의 PCR 산물이 BaYMV 외피단백질 영역과 98%–100% 염기서열이 일치하여 BaYMV를 검출할 수 있음을 확인하였다. 이 결과는 토양으로부터 BaYMV 검출에 관한 최초의 보고이며 토양전염성 바이러스의 정확한 진단과 예찰에 적용될 수 있을 것으로 생각한다.

Acknowledgement

This study was carried out with the support of “Cooperative Research Program for Agricultural Science & Technology Development (Project No. PJ0100422016)” Rural Development Administration, Republic of Korea.

References

Adams M. J, Swaby A. G, Macfarlane I. 1986;The susceptibility of barley cultivars to barley yellow mosaic virus (BaYMV) and its fungal vector Polymyxa graminis. Ann. Appl. Biol 109:561–572. 10.1111/j.1744-7348.1986.tb03213.x.
Bae J. Y, Kim S. M, Kang M. H, Kim K. M, Lee J. H, Ju H. J, Kim S. L, Lee B. C. 2015;Occurrence of barley virus diseases in southern part of Korea. Korean J. Org. Agric 23:859–866. In Korean. 10.11625/KJOA.2015.23.4.859.
Cox B. A, Luo H, Jones R. A. C. 2014;Polymyxa graminis isolates from Australia: identification in wheat roots and soil, molecular characterization, and wide genetic diversity. Plant Dis 98:1567–1575. 10.1094/PDIS-02-14-0128-RE.
Ketta H, Ryšánek P, Zouhar M. 2012;Detection of Polymyxa graminis in a barley crop in the Czech Republic. Plant Protect. Sci 48:65–71.
Ketta H, Zouhar M, Ryšánek P. 2011;First report of Polymyxa graminis f. sp. temperata, a vector of soilborne cereal viruses in the Czech Republic. Plant Dis 95:353. 10.1094/PDIS-05-10-0388.
Li H, Shirako Y. 2015;Association of VPg and eIF4E in the host tropism at the cellular level of Barley yellow mosaic virus and Wheat yellow mosaic virus in the genus Bymovirus. Virology 476:159–167. 10.1016/j.virol.2014.12.010. 25543966.
Park J. C, Lee J. D, Seo J. H, Kim Y. K, Jeong S. G, Kim H. M. 2004;Growth damage and alteration of cellular tissue of barley infected by Barley yellow mosaic virus. Res. Plant Dis 10:34–38. In Korean. 10.5423/RPD.2004.10.1.034.
Park J. C, Noh T. W, Kim M. J, Lee S. B, Park C. S, Kang C. S, Lee J. J, Kim T. S. 2010;Effect of cropping system on disease incidence by soil-borne Bymovirus in barley and on density of the vector Polymyxa graminis. Res. Plant Dis 16:115–120. In Korean. 10.5423/RPD.2010.16.2.115.
Park J. C, Roh T. W, Kim J. G, Kim H. M, So I. Y, Lee K. J. 2007;Strain distinction and their distribution of Barley yellow mosaic virus base on RAPD analysis in Korea. Korean J. Plant Resour 20:511–517.
You Y, Shirako Y. 2013;Evaluation of host resistance to Barley yellow mosaic virus infection at the cellular and whole-plant levels. Plant Pathol 62:226–232. 10.1111/j.1365-3059.2012.02616.x.

Notes

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Article information Continued

Table 1

Primers used for nested PCR on Barley yellow mosaic virus (BaYMV) from soil

PCR Primer Sequence (5’–3’) Product size (bp)
Primary BaYMV575-F TGCAGATGGTAACTGGAGCG 575
BaYMV575-R  GAAGTTAACATGGTGTTATA
Secondary  BaYMV372-F CGCACTCGAATCTGAGCTAAA  372
BaYMV372-R CATGATCGTGGGACGAAGAAA

Fig. 1

Nested PCR scheme for detection of Barley yellow mosaic virus (BaYMV) from soil sample.

Fig. 2

Nested PCR for Barley yellow mosaic virus (BaYMV) from soil samples. (A) Primary PCR. (B) Secondary PCR. Lane M, DNA 100 bp ladder; lanes 1–5, soil samples from barley field; lanes 6–10, soil samples from rice paddy field; P, positive; N, negative control.