search for




 

Identification of Differentially Expressed Genes by cDNA-AFLP in Magnaporthe oryzae
Res. Plant Dis. 2019;25:205-212
Published online December 31, 2019
© 2019 The Korean Society of Plant Pathology.

Myoung-Hwan Chi1 and Sook-Young Park2*

1Plant Biology Division, Noble Research Institute, Ardmore, OK 73401, USA
2Department of Plant Medicine, Sunchon National University, Suncheon 57922, Korea
*Tel: +82-61-750-3868
Fax: +82-61-750-3868
E-mail: spark@scnu.ac.kr
ORCID
https://orcid.org/0000-0003-1267-1111
Received November 24, 2019; Revised December 10, 2019; Accepted December 10, 2019.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Analysis of differentially expressed genes has assisted discovery of gene sets involved in particular biological processes. The purpose of this study was to identify genes involved in appressorium formation in the rice blast fungus Magnaporthe oryzae via analysis of cDNA–amplified fragment length polymorphisms. Amplification of appressorial and vegetative mycelial cDNAs using 28 primer combinations generated over 200 differentially expressed transcript-derived fragments (TDFs). TDFs were excised from gels, re-amplified by PCR, cloned, and sequenced. Forty-four of 52 clones analyzed corresponded to 42 genes. Quantitative real-time PCR showed that expression of 23 genes was up-regulated during appressorium formation, one of which was the MCK1 gene that had been shown to be involved in appressorium formation. This study will be providing valuable resources for identifying the genes such as pathogenicity-related genes in M. oryzae.

Keywords : Appressorium formation, cDNA-AFLP, Gene expression, Magnaporthe oryzae, qRT-PCR
Body
ice blast, caused by Magnaporthe oryzae, is the most devastating disease in rice worldwide (Ebbole, 2007) and destroys 10–30% of rice production annually (Talbot, 2003). As over half of the global human population depends on rice as staple food (Strange and Scott, 2005), intensive research has been conducted to understand its mechanism of pathogenicity towards the goal of developing effective control strategies for the rice blast.

The infection of rice by M. oryzae is initiated by conidial attachment on host surfaces followed by conidial germination. Via recognition of physical cues on the rice surface, such as hydrophobicity and surface hardness, emerging germ tubes initiate formation of a specialized infection structure, called the appressorium, within 4–6 hours (Hamer and Talbot, 1998; Howard and Valent, 1996). The appressorium is a dome-shaped cell that enables the fungus to penetrate the rice leaf surface. Enormous turgor pressure (8 MPa) builds up inside the melanized appressorium due to high glycerol concentration, which drives penetration of the plant surface. After successful infection of plant tissues, visible symptoms appear rapidly. Over two decades of research has unequivocally established the involvement of several signaling pathways, including the cyclic AMP-dependent (Adachi and Hamer, 1998; Lee and Dean, 1993; Mitchell and Dean, 1995; Xu and Hamer, 1996), calcium-dependent (Choi et al., 2009a, 2009b; Liu and Kolattukudy, 1999; Nguyen et al., 2008), and mitogen-activated protein (MAP) kinase signaling pathways (Hamer and Talbot, 1998; Jeon et al., 2008; Soanes et al., 2012; Thines et al., 2000; Xu and Hamer, 1996) in appressorium differentiation.

One notable advantage that has facilitated studies on appressorium differentiation is the possibility to induce appressorium formation on artificial hydrophobic surface as well as hydrophilic surfaces in the presence of cAMP (Lee and Dean, 1993). Multiple approaches have been deployed to identify genes important in M. oryzae appressorium development, including suppression subtractive hybridization (Lu et al., 2005), super serial analysis of gene expression (Irie et al., 2003; Soanes et al., 2012), expressed sequence tag analysis (Oh et al., 2008), and RNA-sequencing (Soanes et al., 2012). Identification of genes expressed in appressoria via such approaches and subsequent functional analysis of identified genes via mutagenesis have helped understand the molecular mechanism underpinning the initiation and maturation of M. oryzae appressorium. Even though a large number of genes involved in appressorium differentiation have been identified via functional validation, many more genes likely remain to be identified.

In this study, we applied cDNA-amplified fragment length polymorphisms (cDNA-AFLP) analysis (Park et al., 2009) to identify and characterize the function of selected genes using the previously constructed ATMT mutant library (Jeon et al., 2007).

M. oryzae strain KJ201 (wild-type) was obtained from the Centre for Fungal Genetic Resources at Seoul National University, Seoul, Korea. All fungal isolates were grown on V8-juice agar (8% V8 juice, pH 6.8) or oatmeal agar (5% oatmeal [w/v], 2% agar [w/v]) at 25°C under constant light to promote conidial production. The wild-type and ATMT mutants were cultured on complete agar medium, minimal agar medium, C starvation medium, and N starvation medium to observe mycelial growth and colony characteristics (Talbot et al., 1997).

Total RNA was isolated from appressoria, formed on hydrophobic glass for 4–6 hr, and mycelia cultured in complete liquid medium. Extracted RNA (5 μg) was used to produce random primed cDNA with the Prom-II Reverse Transcription System (Promega, Madison, WI, USA). Three independent experiments were performed.

This analysis was performed as previously described (Park et al., 2009). cDNA (200 ng) was digested with EcoRI and MspI and ligated to EcoRI and MspI double strand adapters (Park et al., 2009). The products were diluted (50×) with TE buffer and 5 μl were used for selective amplification, using 36 cycles that include 13 touchdown cycles comprising a reduction of the annealing temperature from 65°C to 56°C in 0.7°C steps, which were subsequently maintained for 23 cycles. A total of 28 primer combinations (Table 1) were used for selective amplification as previously described (Park et al., 2009).

Primers used for cDNA-AFLP

Selective primer5’-3’
EcoRI-0 GAC TGC GTA CCA ATT C
EcoRI-AGG GAC TGC GTA CCA ATT CAG G
EcoRI-CAC GAC TGC GTA CCA ATT CCA C
EcoRI-CAG GAC TGC GTA CCA ATT CCA G
MspI-0 GAT GAG TCC TGA GCG G
MspI-C GAT GAG TCC TGA GCG GC
MspI-CT GAT GAG TCC TGA GCG GCT
MspI-CTC GAT GAG TCC TGA GCG GCT C
MspI-CTCA GAT GAG TCC TGA GCG GCT CA
MspI-CTG GAT GAG TCC TGA GCG GCT G
MspI-CTGC GAT GAG TCC TGA GCG GCT GC

cDNA-AFLP, cDNA–amplified fragment length polymorphisms.


Bands of interest were selected, excised from the gel, and re-amplified as previously described (Park et al., 2009). PCR products were confirmed on 1.0% agarose gels. The amplified transcript-derived fragments (TDFs) were cloned into the plasmid pGEM-T Easy vector system I (Promega). Sequencing of cloned TDFs was conducted on an Applied Biosystems sequencer (ABI3700, Applied Biosystems, Foster City, CA, USA).

Database searches were performed using the BLAST Network Service (NCBI, National Center for Biotechnology Information) and the Magnaporthe genome database (http://www.broad.mit.edu/annotation/fungi/magnaporthe/). To determine whether the genes derived from TDFs were orphan genes or had orthologs in other organisms, the BLAST Matrix program incorporated in CFGP (Park et al., 2008) and InParanoid algorithms (Remm et al., 2001) were used. We applied the cutoff e-value of less than 10-50 for protein similarity in BLAST Matrix searches and the InParanoid default parameters.

Quantitative real-time RT-PCR (qRT-PCR) was applied to measure transcript levels using specific primers (Table 2) and the conditions described previously (Park et al., 2013). All reactions were performed with three biological and three technical replicates for each sample. The β-tubulin gene was used as the internal control for normalization. All amplification curves were analyzed with a normalized reporter threshold of 0.1 to obtain the threshold cycle (Ct) values. The comparative ΔΔ Ct method was applied to evaluate relative quantities of each amplified sample product. Fold changes were calculated as 2−ΔΔCt (Livak and Schmittgen, 2001). We applied a fold-change cutoff of ≥1.5 for up-regulation and ≤0.5 for down-regulation.

Primers used for quantitative real-time PCR

Gene locusForward primer (5’-3’)Reverse primer (5’-3’)
MGG_00204T0GTCAAACATTTACCTCGCGCCATAAAGATTGAACCGCCCAG
MGG_00222T0CACCATCTACTCAAACCCCTCTCGAATTGTGGACAGAGCAAG
MGG_00464T0TCCTCTTCACCAACAGCATGGACCAGAGGAAATACGACACC
MGG_00621T0TGTGACCTTGTGCTCTTGTGGACGTGCAACCTCTTTTCATG
MGG_00752T0CTTTGTCGGTGTTTTCCTCAGGCAGCGGAACGAATTTGAAG
MCK1GGTTTTATGCCGGATTTGAGCTCTGTGGGAGCATTTGACTG
MGG_01117T0TCCCAGAAAGTGACCATCAAGGGTCCAAGAACTGAGTGAAGG
MGG_01507T0ATGCCGTCAGAAGCTTATCGCTGCCATTTTCTTATCTCTTTCCG
MGG_02313T0ACAGTATTTCTCCGCCTCAAGTGCCAATATTCGTCTGTGTCC
MGG_03178T0GCCAAGATCATACACTAGACGAGAATCTAACTTGGCTGTCGGG
MGG_03531T0TGGCTTTGATACTGGAACGAGTGAGTGGTTCATGAGGGTTG
MGG_03694T0CCACGATCAGAACAGGAAGGCAGGATAAAGGACATGGAGCTG
MGG_03918T0TCAGCGAATACAAGGACACGCTCTTGGTGATACTGAAGTGGG
MGG_04121T0TTGTCTCGTATGGCTTCAGTGTTCTTAAGTCTCGCGCCAAG
MGG_04212T0CAATGGCACAAACGGTACAGCAAACCCCACGCAAATCAG
MGG_04407T0GTCTGTTGAGAAGCTGTTGCGGACTAGAGCTTGAACTTGGG
MGG_04538T0AGATGTGCCATATTTGCCCCTGACTGTAGCGTTCTCCAAAG
MGG_05592T0AGCTCATCGACTTTGCCTACGGGTTTCGGTCTCGTAGAAG
MGG_05814T0ATCTTGGTCAACTCGCTCATCAGTGAAAGTACTGGATGACGC
MGG_06296T0CCAACTCGACAACGCTCTATGACGAAGCAGAAACCGCAG
MGG_06910T0TGCCAGGTTGATGTTCGTGCCGTGATGTCCTTGTAGTGAG
MGG_06999T0TCCAAAAGTCTCAGTGTCGCAATCTGCCCCTGAAACGG
MGG_08101T0CAAATGGAGAGGTTCAAAGCGTGTCGATCATGTTCCCAAGG
MGG_08114T0AGCCATGTTAAGGAGATGCAGTTCAGTCCATTCATCCCACG
MGG_08303T0ATGTGGCGATGAAGGTCTGGATTTGAGTTTGCTGTCCGTG
MGG_10035T0CATAGTCATTCTTGTCCCACCCATGAGCTTGTTCTCGGTCG
MGG_10380T0TGACCTTTAGCCACGACATTGTCAATCCAGATGAGCTTGGTG
MGG_10431T0AAACCAAACAATGCAGCCGCCCCATGTACTTGTAGCAGTAG
MGG_10668T0ACTACCTAAAGAAACGGCGACCCAGATCGCCAAATACTAGACC
MGG_11494T0AGTGGACAACGGGCATTTAGGCAACACCAGACACTATACCTC
MGG_11809T0CATCACACTTGGCTTTTGGGTCCCTTCATTGTCCCCTTTG
MGG_13902T0TCATCGACCTTTTCAGCCGAAACAAGTCTCCCAGGTTCC
MGG_14593T0GAGGCCGAATGTTTAGAGCTAGGGCATGACTTTTGTTTTCGTTG
MGG_14683T0GCACTTTCACATCTTTCTCGGTTGAGCGTCTGAGTTTGAGG
MGG_14684T0GTGATCAGCTCGTACCTCAGATCTGCGCTGTATCCCATG
MGG_14741T0AGCAGGTAAGGCCAACTAATGGAGTACTTGGACATCGGAATCG
MGG_15150T0TCACGAAAACCCCATCTCATGTGATGTTGAAGGAGCGAGTG
MGG_15282T0TTCGAGTCATTGGGATCTTGGAGGAACTTGGTCGGCATATC
MGG_16167T0CTTGCCATCAAACTCGACAACTTCTGTGGTATGTGGGTTGG
MGG_16535T0CAGATAGAGCAACAGAGGCAGGTCCATGGTCCTGCATTTTG
MGG_17376T0GCCGATGCTTGTATTACCAACCAGAGTATGAGGTGCTGTAGTG
MGG_17847T0CTTGCCATCAAACTCGACAACTTCTGTGGTATGTGGGTTGG
β-TubulinACAACTTCGTCTTCGGTCAGGTGATCTGGAAACCCTGGAG

Isolation of differentially expressed TDFs

To isolate TDFs corresponding to differentially expressed genes during appressorium development in M. oryzae, cDNA-AFLP analysis was performed using RNAs extracted from appressoriumforming conidia on hydrophobic glass and vegetatively grown mycelia in complete liquid medium.

A total of 28 primer combinations were used (Table 1). Resulting fragments were ranged in size from 50 to 1,200 bp. Over 200 TDFs that appeared to be differentially expressed genes were detected. Each band was directly excised from the gel, eluted, and re-amplified using the same primer set. Among the 200 TDFs, 52 were successfully cloned and sequenced. In order to obtain more up-regulated or differentially expressed genes during appressorium development, additional primer combinations for cDNA-AFLP could be helpful.

Identification of up-regulated genes during appressorium formation

The GenBank nucleotide sequence database (http://blast.ncbi.nlm.nih.gov/Blast) and Magnaporthe database (http://www.broad.mit.edu/annotation/fungi/magnaporthe/) were queried using sequences of the 52 TDFs via the BLAST (Basic Local Alignment Search Tool) program. The majority (44 TDFs) matched to M. oryzae genes (Table 3). Based on blast search, we identified 42 independent genes that are likely associated with appressorium development. Among 44 TDFs, 2 TDFs are identical sequence to two TDFs which identified as MGG_01117T0 and MGG_15150T0, respectively.

List of 44 transcript-derived fragments corresponding to 42 genes and the relative abundance of their transcripts during appressorium development

Locusa. a. lengthPutative function
MGG_00204T00515Hypothetical protein
MGG_00222T00652Dynactin Arp1 p62 subunit RO2
MGG_00464T00516MFS phospholipid transporter Git1
MGG_00621T00948Beta-hexosaminidase
MGG_00752T00197Hypothetical protein
MGG_00883T01,528Mitogen activated protein kinase kinase kinase3
MGG_01117T00740Conserved hypothetical protein
MGG_01507T00694Acetylglutamate synthase
MGG_02313T03,298Conserved hypothetical protein
MGG_03178T00229Conserved hypothetical protein
MGG_03531T00571Conserved hypothetical protein
MGG_03694T00503Beclin-1
MGG_03918T00696Protein phosphatase 1K, mitochondrial precursor
MGG_04121T00249Hypothetical protein
MGG_04212T00563L-ornithine 5-monooxygenase (OMO1)
MGG_04407T00481Cation efflux family protein
MGG_04538T00584Conserved hypothetical protein
MGG_05592T00541Conserved hypothetical protein
MGG_05814T00470Potassium-activated aldehyde dehydrogenase
MGG_06296T00185Nuclear cap-binding protein subunit 2
MGG_06910T00770Transport protein SEC23
MGG_06999T00514Hypothetical protein
MGG_08101T00665CCR4-NOT transcription complex
MGG_08114T00855Hypothetical protein
MGG_08303T00734XPG N-terminal domain-containing protein
MGG_10035T00299Conserved hypothetical protein
MGG_10380T00426Cystathionine gamma-lyase
MGG_10431T00793Extracellular cell wall glucanase Crf1
MGG_10668T00494Ceramide glucosyltransferase
MGG_11494T00478DUF124 domain protein
MGG_11809T00740Hypothetical protein
MGG_13902T00802Conserved hypothetical protein
MGG_14593T00312Hypothetical protein
MGG_14683T00594Hypothetical protein
MGG_14684T00060Hypothetical protein
MGG_14741T00245Predicted protein
MGG_15150T00108Conserved hypothetical protein
MGG_15282T00619Conserved hypothetical protein
MGG_16167T00535Hypothetical protein
MGG_16535T00224Hypothetical protein
MGG_17376T00083PP-loop family protein
MGG_17847T00728Hypothetical protein

The genes up-regulated during appressorium development included the following: homologues of the dynactin Arp1 P62 subunit RO2 (MGG_00222T0) (Lee et al., 2001), which regulates the activity of cytoplasmic dynein (a microtubule-associated motor); a gene encoding mitogen activated protein kinase kinase kinase3, MCK1 (MGG_00883T0) (Jeon et al., 2008), which is an integral component of the MAP kinase signaling pathway that regulates cell wall integrity in Saccharomyces cerevisiae (Levin, 2005) and M. oryzae (Jeon et al., 2008); a gene homologous to S. cerevisiae Git1 (MGG_00464T0), which encodes a permease involved in glycerophosphoinositol uptake (Patton-Vogt and Henry, 1998); beta-hexosaminidase (MGG_00621T0) homologue; a homologue of glycosylphosphatidylinositol-anchored extracellular cell wall glucanase Crf1 of Aspergillus fumigatus (MGG_10431T0) (Arroyo et al., 2007); and a pp-loop family protein (MGG_17376T0) homologue (Table 3).

The genes specifically expressed during appressorium development also included a gene putatively encoding acetylglutamate synthase (MGG_01507T0), a gene involved in autophagy; ATG6 (MGG_03694T0), which encodes a protein that forms a membrane-associated complex with ATG14p in S. cerevisiae and is critical for M. oryzae pathogenicity; protein phosphatase 1K (MGG_03918T0); L-ornithine 5-monooxygenase OMO1 (MGG_04212T0); cation efflux family protein (MGG_04407T0); potassiumactivated aldehyde dehydrogenase (MGG_05814T0); nuclear cap-binding protein subunit2 (MGG_06296T0); transport protein SEC23 (MGG_06910T0); CCR4-NOT transcription complex (MGG_08101T0); XPG N-terminal domain-containing protein (MGG_08303T0); cystathionine gamma-lyase (MGG_10380T0); ceramide glucosyltransferase (MGG_10668T0); and DUF124 domain protein (MGG_11494) (Table 3).

Among the 42 genes, only seven (MGG_00222T0, MGG_00464T0, MGG_03694T0, MGG_04538T0, MGG_10380T0, MGG_11809T0, and MGG_15282T0) had already been identified in a previous study (Soanes et al., 2012). The remaining 35 genes were not previously captured in appressorial transcriptome studies in M. oryzae (Oh et al., 2008; Soanes et al., 2012). This low redundancy level compare to other previous transcriptome analysis (Oh et al., 2008; Soanes et al., 2012) might be due to one or more of the following differences among these experiments: (1) differences in experimental methods; (2) inductive surface and treatments for appressorium development; (3) time points for sample collection; (4) differences between strains used; and (5) Magnaporthe genome versions used.

To determine whether the 42 genes have orthologs in other species, we applied BLAST Matrix (http://cfgp.snu.ac.kr) and InParanoid (Remm et al., 2001) to detect orthologs (Fig. 1). We found 5 genes (MGG_14593T0, MGG_15150 T0, MGG_14683 T0, MGG_14684 T0, and MGG_14741 T0) were M. oryzae-specific, based on the absence of orthologs in other species (BLAST E < 10-50 and InParanoid) (Fig. 1). Further examination is needed to determine whether these genes play an important role during M. oryzae appressorium devel opment and/or pathogenesis.

Fig. 1.

Distribution of 42 appressorium-specific genes analyzed using BLAST Matrix and InParanoid algorism. Abbreviation for fungal species and other organisms: Pi, Phytophthora infestans; Mgr, Mycosphaerella graminicola; Af1, Aspergillus fumigatus Af293; An, Aspergillus nidulans; Ci, Coccidioides immitis; Hc8, Histoplasma capsulatum H88; Bg, Blumeria graminis f. sp. hordei; Bc, Botrytis cinerea; Cg, Colletotrichum graminicola M1.001; Fg, Fusarium graminearum; Fol, Fusarium oxysporum; Mo, Magnaporthe oryzae 70-15; Nc, Neurospora crassa; Pa, Podospora anserina; Cas, Candida albicans SC5314; Sc, Saccharomyces cerevisiae S288C; Sp, Schizosaccharomyces pombe; Hi, Heterobasidion irregulare TC32-1; Lb, Laccaria bicolor; Pc, Phanerochaete chrysosporium; Sl7, Serpula lacrymans S7.3; Ecu, Encephalitozoon cuniculi JAM81; Pbl, Phycomyces blakesleeanus; Ro, Rhizopus oryzae; Dm, Dorosophila melanogaster; Hs, Homo sapiens; Ce, Caenorhabditis elegans; Ath, Arabidopsis thaliana; Osj, Oryza sativa japonica. Red bar, M. oryzae-specific; orange bar, Ascomycota-specific; blue bar, fungal-specific; gray bar, conserved in whole organisms that we used in this study.


We also found that 10 genes (MGG_00222T0, MGG_00752T0, MGG_01117T0, MGG_01507T0, MGG_02313T0, MGG_10431T0, MGG_11494T0, MGG_11809T0, MGG_03918T0, and MGG_04212T0) were Ascomycota-specific (particularly in Pezizomycotina), 6 additional genes (MGG_08303T0, MGG_03694T0, MGG_06999T0, MGG_06296T0, MGG_00204T0, and MGG_00464T0) were fungal-specific, and 2 genes (MGG_08101T0 and MGG_06910T0) were conserved in all organisms included in the analysis (Fig. 1).

Validation of expression patterns by qRT-PCR

To validate gene expression patterns suggested by cDNA-AFLP analysis, qRT-PCR analysis was conducted. A total of 23 genes (54.8%) were up-regulated, 9 genes (21.4%) were down-regulated, and 10 genes (23.8%) were not differentially expressed (Fig. 2).

Fig. 2.

Quantitative real-time PCR analysis of gene expression during appressorium development. Up-regulated genes (more than 2 fold) are indicated by red bars, down-regulated genes (less than 0.5 fold) are marked by blue bars. The genes did not show differentially expression are noted in black.


MGG_04212T0 encodes an L-ornithine 5-monooxygenase (OMO1), which is the key precursor for all hydroxamate siderophore biosynthesis in fungi (Eisendle et al., 2003; Schrettl et al., 2007). The siderophore is known to be required for virulence in A. fumigatus (Schrettl et al., 2007). We found that OMO1 expression was significantly up-regulated during appressorium formation (Fig. 1). Previous studies revealed that overcoming host-driven oxidative stress was a prerequisite for full pathogenicity in rice blast fungus (Chi et al., 2009; Huang et al., 2011). We previously showed homeostatic regulation of ferrous ion might serve an important role in pathogenicity via overcoming oxidative stress (Chi et al., 2009).

Similarly, MGG_04407T0, which encodes a putative cation efflux protein, and is also required for regulation of metal ion concentration. Further investigation is required to elucidate the roles of MGG_04212T0 and MGG_04407T0 in M. oryzae pathogenicity and metal ion regulation.

cDNA-AFLP, sequencing and qRT-PCR can be combined for effective identification of differentially expressed genes under specific conditions. Using these approaches, we have identified and confirmed differentially expressed genes during appressorium formation in M. oryzae. Subsequent expression, bioinformatics, and functional validation revealed interesting pathogenicity-related genes in M. oryzae. Further gene knock-out analysis would determine the role of these genes in appressorium development and/or pathogenicity.

Acknowledgments

The authors grateful to Jongbum Jeon for assistance in analysis of overall data. This work was supported by the National Research Foundation of Korea grant funded by the Korean government (NRF-2017R1D1A1B04035888).

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

References
  1. Adachi, K., and Hamer, J. E.. 1998. Divergent cAMP signaling pathways regulate growth and pathogenesis in the rice blast fungus Magnaporthe grisea. Plant Cell 10: 1361-1374.
    Pubmed KoreaMed CrossRef
  2. Arroyo, J., Sarfati, J., Baixench, M. T., Ragni, E., Guillen, M., and Rodriguez-Pena, J. M. et al. 2007. The GPI-anchored gas and Crh families are fungal antigens. Yeast 24: 289-296.
    Pubmed CrossRef
  3. Chi, M.-H., Park, S.-Y., Kim, S., and Lee, Y.-H.. 2009. A novel pathogenicity gene is required in the rice blast fungus to suppress the basal defenses of the host. PLoS Pathog. 5.
    Pubmed KoreaMed CrossRef
  4. Choi, J., Kim, Y., Kim, S., Park, J., and Lee, Y.-H.. 2009a. MoCRZ1, a gene encoding a calcineurin-responsive transcription factor, regulates fungal growth and pathogenicity of Magnaporthe oryzae. Fungal Genet. Biol. 46: 243-254.
    Pubmed CrossRef
  5. Choi, J. H., Kim, Y., and Lee, Y.-H.. 2009b. Functional analysis of MCNA, a gene encoding a catalytic subunit of calcineurin, in the rice blast fungus Magnaporthe oryzae. J. Microbiol. Biotechnol. 19: 11-16.
    Pubmed
  6. Ebbole, D. J.. 2007. Magnaporthe as a model for understanding hostpathogen interactions. Annu. Rev. Phytopathol. 45: 437-456.
    Pubmed CrossRef
  7. Eisendle, M., Oberegger, H., Zadra, I., and Haas, H.. 2003. The siderophore system is essential for viability of Aspergillus nidulans: functional analysis of two genes encoding l-ornithine N 5-monooxygenase (sidA) and a non-ribosomal peptide synthetase (sidC). Mol. Microbiol. 49: 359-375.
    Pubmed CrossRef
  8. Hamer, J. E., and Talbot, N. J.. 1998. Infection-related development in the rice blast fungus Magnaporthe grisea. Curr. Opin. Microbiol. 1: 693-697.
    Pubmed CrossRef
  9. Howard, R. J., and Valent, B.. 1996. Breaking and entering: host pen etration by the fungal rice blast pathogen Magnaporthe grisea. Annu. Rev. Microbiol. 50: 491-512.
    Pubmed CrossRef
  10. Huang, K., Czymmek, K. J., Caplan, J. L., Sweigard, J. A., and Donofrio, N. M.. 2011. HYR1-mediated detoxification of reactive oxygen species is required for full virulence in the rice blast fungus. PLoS Pathog. 7.
    Pubmed KoreaMed CrossRef
  11. Irie, T., Matsumura, H., Terauchi, R., and Saitoh, H.. 2003. Serial Analysis of Gene Expression (SAGE) of Magnaporthe grisea: genes involved in appressorium formation. Mol. Genet. Genomics 270: 181-189.
    Pubmed CrossRef
  12. Jeon, J., Goh, J., Yoo, S., Chi, M.-H., Choi, J., and Rho, H.-S. et al. 2008. A putative MAP kinase kinase kinase, MCK1, is required for cell wall integrity and pathogenicity of the rice blast fungus, Magnaporthe oryzae. Mol. Plant Microbe Interact. 21: 525-534.
    Pubmed CrossRef
  13. Jeon, J., Park, S.-Y., Chi, M.-H., Choi, J., Park, J., and Rho, H.-S. et al. 2007. Genome-wide functional analysis of pathogenicity genes in the rice blast fungus. Nat. Genet. 39: 561-565.
    Pubmed CrossRef
  14. Lee, I. H., Kumar, S., and Plamann, M.. 2001. Null mutants of the neurospora actin-related protein 1 pointed-end complex show distinct phenotypes. Mol. Biol. Cell 12: 2195-2206.
    Pubmed KoreaMed CrossRef
  15. Lee, Y.-H., and Dean, R. A.. 1993. cAMP regulates infection structure formation in the plant pathogenic fungus Magnaporthe grisea. Plant Cell 5: 693-700.
    Pubmed KoreaMed CrossRef
  16. Levin, D. E.. 2005. Cell wall integrity signaling in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 69: 262-291.
    Pubmed KoreaMed CrossRef
  17. Liu, Z.-M., and Kolattukudy, P. E.. 1999. Early expression of the calmodulin gene, which precedes appressorium formation in Magnaporthe grisea, is inhibited by self-inhibitors and requires surface attachment. J. Bacteriol. 181: 3571-3577.
    Pubmed KoreaMed CrossRef
  18. Livak, K. J., and Schmittgen, T. D.. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25: 402-408.
    Pubmed CrossRef
  19. Lu, J.-P., Liu, T.-B., and Lin, F.-C.. 2005. Identification of mature appressorium- enriched transcripts in Magnaporthe grisea, the rice blast fungus, using suppression subtractive hybridization. FEMS Microbiol. Lett. 245: 131-137.
    Pubmed CrossRef
  20. Mitchell, T. K., and Dean, R. A.. 1995. The cAMP-dependent protein kinase catalytic subunit is required for appressorium formation and pathogenesis by the rice blast pathogen Magnaporthe grisea. Plant Cell 7: 1869-1878.
    Pubmed KoreaMed CrossRef
  21. Nguyen, Q. B., Kadotani, N., Kasahara, S., Tosa, Y., Mayama, S., and Nakayashiki, H.. 2008. Systematic functional analysis of calciumsignalling proteins in the genome of the rice-blast fungus, Magnaporthe oryzae, using a high-throughput RNA-silencing system. Mol. Microbiol. 68: 1348-1365.
    Pubmed CrossRef
  22. Oh, Y., Donofrio, N., Pan, H., Coughlan, S., Brown, D. E., and Meng, S. et al. 2008. Transcriptome analysis reveals new insight into appressorium formation and function in the rice blast fungus Magnaporthe oryzae. Genome Biol. 9: R85.
    Pubmed KoreaMed CrossRef
  23. Park, J., Park, B., Jung, K., Jang, S., Yu, K., and Choi, J. et al. 2008. CFGP: a web-based, comparative fungal genomics platform. Nucleic Acids Res. 36: D562-D571.
    Pubmed KoreaMed CrossRef
  24. Park, S.-Y., Choi, J., Lim, S.-E., Lee, G.-W., Park, J., and Kim, Y. et al. 2013. Global expression profiling of transcription factor genes provides new insights into pathogenicity and stress responses in the rice blast fungus. PLoS Pathog. 9.
    Pubmed KoreaMed CrossRef
  25. Park, S.-Y., Jwa, N.-S., Chi, M.-H., and Lee, Y.-H.. 2009. A fluorescencebased cDNA-AFLP method for identification of differentially expressed genes. Plant Pathol. J. 25: 184-188.
    CrossRef
  26. Patton-Vogt, J. L., and Henry, S. A.. 1998. GIT1, a gene encoding a novel transporter for glycerophosphoinositol in Saccharomyces cerevisiae. Genetics 149: 1707-1715.
    Pubmed KoreaMed
  27. Remm, M., Storm, C. E. V., and Sonnhammer, E. L. L.. 2001. Automatic clustering of orthologs and in-paralogs from pairwise species comparisons. J. Mol. Biol. 314: 1041-1052.
    Pubmed CrossRef
  28. Schrettl, M., Bignell, E., Kragl, C., Sabiha, Y., Loss, O., and Eisendle, M. et al. 2007. Distinct roles for intra- and extracellular siderophores during Aspergillus fumigatus infection. PLoS Pathog. 3: 1195-1207.
    Pubmed KoreaMed CrossRef
  29. Soanes, D. M., Chakrabarti, A., Paszkiewicz, K. H., Dawe, A. L., and Talbot, N. J.. 2012. Genome-wide transcriptional profiling of appressorium development by the rice blast fungus Magnaporthe oryzae. PLoS Pathog. 8.
    Pubmed KoreaMed CrossRef
  30. Strange, R. N., and Scott, P. R.. 2005. Plant disease: a threat to global food security. Annu. Rev. Phytopathol. 43: 83-116.
    Pubmed CrossRef
  31. Talbot, N. J.. 2003. On the trail of a cereal killer: exploring the biology of Magnaporthe grisea. Annu. Rev. Microbiol. 57: 177-202.
    Pubmed CrossRef
  32. Talbot, N. J., Mccafferty, H. R. K., Ma, M., Koore, K., and Hamer, J. E.. 1997. Nitrogen starvation of the rice blast fungus Magnaporthe grisea may act as an environmental cue for disease symptom expression. Physiol. Mol. Plant Pathol. 50: 179-195.
    CrossRef
  33. Thines, E., Weber, R. W. S., and Talbot, N. J.. 2000. MAP kinase and protein kinase A-dependent mobilization of triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe grisea. Plant Cell 12: 1703-1718.
    Pubmed KoreaMed CrossRef
  34. Xu, J.-R., and Hamer, J. E.. 1996. MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea. Genes Dev. 10: 2696-2706.
    Pubmed CrossRef


December 2019, 25 (4)