search for




 

Rice Blast Populations Isolated from the Border Area of North Korea
Res. Plant Dis. 2019;25:164-172
Published online December 31, 2019
© 2019 The Korean Society of Plant Pathology.

Hyunjung Chung1, Jae-Hwan Roh2, Jung-Wook Yang1, Hyeong-Kwon Shim1, Da Gyeong Jeong1, Joo Yeon Kim1, Jin Young Shin1, In Jeong Kang1, and Sunggi Heu1*

1Crop Cultivation & Environment Research Division, National Institute of Crop Science, Rural Development Administration, Suwon 16613, Korea
2Bioenergy Crop Research Institute, National Institute of Crop Science, Rural Development Administration, Muan 58545, Korea
*Tel: +82-31-695-0662
Fax: +82-31-695-4095
E-mail: sunggiheu@korea.kr
Received October 30, 2019; Accepted December 7, 2019.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Rice blast disease caused by Magnaporthe oryzae is the most important disease of rice in both South and North Korea. Cultivation of disease-resistant cultivar is the best way to prevent this notorious disease, but M. oryzae races have been continuously changed to adapt a new cultivar. Therefore, it is important to get the information about the race and avirulence genes of the pathogen for developing blast-resistant rice cultivar. Since the entrance of North Korea was prohibited, the information about the races of M. oryzae in North Korea border areas and South Korea was collected to get the information about the diversity of rice blast pathogen in North Korea. The disease occurrence on monogenic lines carrying single resistant gene was investigated in Jeonju, Suwon, Cheorwon, Goseong, and Baengnyeongdo in Korea, and Dandong in China. The monogenic lines in Jeonju and Suwon showed diverse ranges of the response, while those in Baengnyeongdo and Dandong showed relatively high resistant responses to rice blast. All the field isolates of M. oryzae were characterized for rice blast races by the Korean differential varieties and screened for known avirulence genes to determine the spatial distribution of avirulence genes and the population of M. oryzae.

Keywords : Avirulence gene, Border areas of North Korea, Race differentiation, Resistance gene, Rice blast
서 론

Magnaporthe oryzae라는 ascomycetes 곰팡이에 의하여 병이 발생하는 도열병은 벼 재배에서 가장 문제가 되는 병의 하나이다. 전 세계적으로 도열병 발생에 의한 벼 수확량 손실은 10–30%까지 이르며 감수성 품종의 경우 벼 생산량의 65%까지 감소가 발생한다고 보고되었다(Li 등, 2007). 도열병균은 벼의 전 생육기에 걸쳐 감염이 가능하며 병 발생 부위에 따라 잎도열병, 목도열병, 이삭도열병 등으로 명칭을 달리한다. 도열병균이 오랜 공진화 과정을 거치며 벼에 기생하면서 벼와 도열병균의 관계는 gene-for-gene과 같은 기주와 기생체 상호작용 연구분야에 모델 시스템으로 자리잡고 있다. 현재까지 약 100여 개의 저항성 유전자(resistance gene, R gene)가 유전자좌에 mapping되어 있으며 그 중 35여 개가 cloning되어 있다. 도열병균의 비병원성 유전자(avirulence gene, Avr gene)는 약 24개가 mapping되어 있으며 그 중 12개가 cloning되어 있다(Wang 등, 2017). 벼 재배 지역에서 발생하는 도열병균의 레이스 분포와 비병원성 유전자를 파악하면 그에 상응하는 저항성 유전자를 찾아 저항성 품종의 육성을 통하여 도열병 발생을 감소시킬 수 있다. 그러므로 각 지역에서 발생하는 도열병균의 레이스를 파악하는 것이 저항성 품종 육성의 가장 기본이 될 것이다.

북한에서 벼 도열병은 벼열병이라는 명칭으로 불리며 벼 흰잎마름병과 함께 가장 중요한 병해 중 하나로 보고되고 있다(Chung 등, 2019). Chung 등(2019)의 연구 결과에 의하면 북한에서 개발한 주요 벼 품종은 대부분 남한의 대표 도열병 균주들에 대하여 감수성 반응을 보였다. 만약 남한에서 분포하 고 있는 도열병균 레이스와 같은 도열병균들이 북한에도 분포하고 있다면 북한의 주요 벼 품종들은 대부분 도열병에 감수성 반응을 보일 것이며, 또한 질소비료 시비에 따라 급격히 병 발생이 증가하는 도열병의 특성상 북한에 비료가 풍부해질 경우 북한의 벼 생산에 심각한 문제로 작용할 것이다. 또한 북한에는 남한에서 전혀 발견되지 않은 도열병균 레이스가 분포할 수 있으며, 이러한 균들이 남한 벼 품종에 병을 일으킨다면 남한의 벼 생산에도 큰 피해가 일어날 수 있다. 이러한 우려를 고려하여 본 연구에서는 북한에서 발생하는 벼 도열병균의 레이스 분포 및 비병원성 유전자를 확인하고자 하였다. 남한과 북한은 한반도로 연결되어 있으나 비무장 지대로 나뉘어져 있어 현 재 북한에 접근할 수 없다. 북한에 직접 들어가 조사를 할 수 없는 상황에서 북한에서 발생하는 도열병균의 레이스 분포를 추정할 수 있는 방법은 북한 접경지역인 옹진군 백령도, 강원도 고성 그리고 철원, 중국 단둥 등지에서 도열병을 수집하여 분석하는 것이다. 옹진군 백령도는 북한 황해남도와 접해 있으며 강원도 고성과 철원은 각각 북한의 강원도 고성과 철원에 접해 있고 중국 단둥은 북한의 신의주와 접해 있다. 본 연구에서는 이러한 북한 접경지역에서 단인자 저항성 유전자를 가지는 계통들을 이용하여 그 지역에서 자연적으로 발생하는 도열병균과 단인자 저항성 계통 간의 친화성을 조사하였다.

현재 우리나라에서는 Tetep, 태백, 통일, 유신, 관동, 농백, 진흥, 낙동 등 8개의 선별된 판별품종에 도열병균을 접종 후 병 반응에 따라 레이스를 확인하는 방법인 한국형 판별시스템을 사용하여 도열병균의 레이스를 판단하고 있으며, 도열병균의 비병원성 유전자를 조사하기 위하여 단인자 저항성 유전자가 도입되어 있는 단인자 저항성 품종에 접종하여 병 반응을 통해 육종에 유효한 저항성 유전자를 조사하고 있다(Kim 등, 2017). 최근에는 단인자 저항성 품종을 이용한 병 반응 조사뿐만 아니라 중합효소연쇄반응(polymerase chain reaction, PCR)을 통해 선행연구에서 알려져 있는 비병원성 유전자를 간단히 탐색하는 방법이 개발되고 있으며, 비병원성 유전자의 유무 비율과 저항성 반응 비율이 완전히 일치하여 비병원성 유전자에 대한 PCR 결과를 이용하여 벼 육종에 유효한 저항성 유전자를 찾을 수 있다고 보고하였다(Selisana 등, 2017; Shi 등, 2018). 이를 토대로 본 연구에서는 북한 접경지역에서 자연적으로 발생하는 도열병균의 레이스를 확인하였고 비병원성 유전자를 분석하여 유효한 저항성 유전자 탐색이 가능한지를 알아보았다.

재료 및 방법

벼 품종 및 계통

본 연구에서 사용한 단인자 계통은 국제미작연구소(International Rice Research Institute, IRRI)에서 중국 자포니카 도열병 감수성 품종인 Lijianxintuanheigu (LTH)에 단일 저항성 유전자를 도입하여 육성한 계통으로, 단일 저항성 유전자 23개를 도입한 23개 계통과 대조군인 LTH를 밭못자리 검정 시험에 이용하였다(Table 1) (Tsunematsu 등, 2000).

도열병 밭못자리 검정

밭못자리 검정은 북한 접경지역인 옹진군 백령도, 강원도 고성, 철원과 남한 내륙지역인 전라북도 전주, 경기도 수원을 포함한 5개 지역에서 단인자 저항성 계통을 이용하여 수행하였다. 파종은 6월 하순에서 7월 상순에 이루어졌으며, 파종 거리는 계통당 간격 10 cm×길이 20 cm로 하였다. 시비량은 10a당 질소 24 kg, 인산 9 kg, 염화가리 9 kg을 사용하였고, 도열병 발생 유도를 위하여 단인자 저항성 계통 주위에 감수성 품종인 낙동과 호평을 spreader로 파종하였다. 도열병 발생 조사는 파종한 약 30일 후에 IRBN 밭못자리 표준 검정법에 준하여 발병 정도(0–9)를 조사하였다. 0–3은 저항성, 4–6은 중도 저항성, 7–9는 감수성으로 본다(International Rice Research Institute, 1988).

도열병균 단포자 분리

북한 접경지역 및 남한 내륙지역에 도열병 검정용 밭못자리로부터 수집한 벼 잎도열병 이병식물에서 병원균 총 334균주를 단포자 분리하였다. 단포자 분리를 위하여 도열병 병반을 물한천 배지(water agar; 한천 15 g, 증류수 1 l)에 올려놓아 26°C 항온기에서 1–2일간 습실 처리하여 포자형성을 유도하였다. 도열병균 포자가 형성된 병반으로부터 실체현미경 혹은 광학현미경 아래에서 백금선 루프를 이용하여 포자를 채취한 후 물한천 배지에 산포시켜 1일간 26°C 항온기에서 배양하였다. 배양한 포자를 해부현미경 50배율 아래에서 떼어 감자한천배지(potato dextrose agar)에 옮겨 순수 분리하였다.

접종원 준비

도열병균 포자형성을 위하여 감자한천배지에서 약 10일간 배양한 균총 절편을 2 ml의 살균증류수에 떼어 넣고 살균한 봉으로 균사 절편을 마쇄한 후, 그 현탁액을 쌀겨배지(rice polish agar; 쌀겨 20 g, 설탕 20 g, 한천 20 g, 증류수 1 l)에 접종하였다. 접종한 배지는 26oC 항온기에서 7일간 배양하여 균사가 쌀겨배지 표면에 가득 자라도록 한 후, 살균된 고무 브러시를 이용하여 기중 균사를 긁어 제거하고 페트리 디쉬 뚜껑을 열어 형광등 50 cm 하단에서 3일간 지속적으로 빛을 조사하여 분생포자 형성을 유도하였다. 포자 현탁액은 분생포자가 형성된 쌀겨배지에 Tween 20 희석액(5,000 배액)을 부어 고무브러시를 이용하여 긁어낸 후 거즈에 걸러 준비하였다. 포자 농도는 2–5×105 포자/ml로 조절하였다(Goh 등, 2013).

판별품종을 이용한 레이스 검정

도열병균의 레이스를 판별하기 위하여 한국형 판별품종 8개(Tetep, 태백, 통일, 유신, 관동, 농백, 진흥, 낙동)를 이용하여 병원균 접종을 수행하였다. 3–4엽기의 유묘에 도열병균 포자 현탁액을 25 ml씩 진공압축기(compressor)를 이용한 유리 스프레이로 분무 접종하였다. 접종한 벼는 26°C 포화습도 접종상에 넣어 24시간 동안 암조건에서 습실 처리하고 온실에 옮겨 7일간 정치하여 발병시켰다. 발병조사는 식물체 전체 잎에 형성된 병반형과 병반수를 IRRI 조사기준(Bandong 과 Ou, 1966)에 따라 발병지수 0–5로 조사하였고, 0–2는 저항성, 3은 중도(저항성)이병성, 4–5는 이병성으로 구분하였다. 레이스 판별은 Lee 등(1987)이 제안한 레이스 판별법에 따라 분류하였다.

Genomic DNA 추출 및 PCR 증폭

도열병균 genomic DNA 추출을 위하여 지열별로 분리한 균주를 감자한천배지 혹은 완전영양액체배지(설탕 10 g, 효모 추출물 6 g, 카사미노산 6 g, 증류수 1 l)에 접종하여 26°C 항온기에서 배양하였다. 감자한천배지에서 자란 균사 절편은 한천을 제거한 후 살균한 봉을 이용하여 마쇄하였고, 완전영양액체배지에서 배양한 균사는 수거하여 동결건조 후 살균한 봉을 이용하여 마쇄하였다. Genomic DNA는 마쇄한 균사로부터 NucleoSpin Plant II kit (Macherey-Nagel, Duren, Germany)를 이용하여 추출하였다. 추출한 genomic DNA로부터 PCR 증폭은 11개 비병원성 유전자(Avr-Pi9, Avr-Pita1, Avr-Pita2, Avr-Pita3, AvrPiz-t, Avr-Pik, Avr-Pikm, PWL2, ACE1, Avr-Pii, Avr-Pia)에 특이적인 프라이머 쌍(Table 2)과 AccuPower PCR PreMix (Bioneer, Daejeon, Korea)를 이용하여 사용설명서에 따라 수행하였다.

The responses of natural Magnaporthe oryzae to monogenic resistance lines in different area

Resistance linesR geneAvr geneThe response of monogenic lines in different locationsa

JeonjuSuwonCheorwonGoseongBaengnyeongdoDandongb
IRBL20-IR24Pi20-100333
IRBL19-APi19-303303
IRBLta-K1PitaAvr-Pita576458
IRBL12-MPi12-175453
IRBLta2-PiPita-2Avr-Pita2247002
IRBLzt-TPiz-tAvrPiz-t230433
IRBLz5-CAPiz-5-341455
IRBLz-FuPiz-998400
IRBL9-WPi9Avr-Pi9210533
IRBL7-MPi7-79NDc063
IRBLkp-K60Pik-pAvr-Pik/km/kp543643
IRBLk-KaPikAvr-Pik/km/kp794504
IRBLkh-K3Pik-h-364889
IRBL1-CLPi1-776654
IRBLkm-TsPik-mAvr-Pik/km/kp257454
IRBLks-F5Pik-s-568536
IRBL5-MPi5-585533
IRBL3-CP4Pi3-565766
IRBLi-F5PiiAvrPii777766
IRBLa-APiaAvrPia776879
IRBLt-K59Pit-243415
IRBLb-BPibAvr-Pib787303
IRBLsh-BPish-350576
LTH--774566

aThe response level had been divided into 0–9: 0, no lesion & no disease symptom; 1, small brown specks of pin point size, no spores; 2, small roundish to slightly elongated brown spots, necrotin gray spots; 3, lesion type is the same as in 2, but significant number of lesion are on the upper leaves; 4, typical susceptible blast lesions, infecting less than 2% of the leaf area; 5, typical susceptible blast lesions, infecting 2–10% of the leaf area; 6, typical susceptible blast lesions, infecting 11–25% of the leaf area; 7, typical susceptible blast lesions, infecting 26–50% of the leaf areas; 8, typical susceptible blast lesions, infecting 51–75% of the leaf areas; 9, typical susceptible blast lesions, infecting more than 75% of the leaf area, almost withered (from rice blast resistance screening).

bAll data had collected on 2018 except Dandong data had been collected on 2019.

cData had not been collected.


List of sequences used as markers for avirulence genes

GenePrimerSequence (5’→3’)Tm (°C)aReference
Avr-Pi9Avr-Pi9_F1ATGCAGTTCTCTCAGATCCTC55Selisana et al. (2017)
Avr-Pi9_R2CTACCAGTGCGTCTTTTCGAC
Avr-Pita1Avr-Pita1_F1GCCGAGTCGTTCTGA56Shi et al. (2018)
Avr-Pita1_R2TGTTAATTGTGCAGAAGTTTTT
Avr-Pita2Avr-Pita2_F1TTGGCACCTTTTCATACCCAGTTT60Shi et al. (2018)
Avr-Pita2_R2CAACTTACTTGTGAATCCCATCCC
Avr-Pita3Avr-Pita3_F1ACCGACCCAGGAAAAAAG61Shi et al. (2018)
Avr-Pita3_R2AAGAAACAGGCAAACGCA
AvrPiz-tAvrPiz-t_F1GTTGCGATTATGATCCGTCG57Selisana et al. (2017)
AvrPiz-t_R2GTACTCTAGCAAACGACCGG
Avr-PikAvr-Pik_F1TCCTGCTGCTAACTCCATTC57Selisana et al. (2017)
Avr-Pik_R1TCAACCAAGCGTAAACCTCG
Avr-PikmAvr-Pikm_F1CTGTGGACTAAGTAGCATGCTTCT62Shi et al. (2018)
Avr-Pikm_R2TAGGCAATCAAGAGAAAGCCAGTA
Avr-PiaAvr-Pia_F1CAGAGAAACGGACTTGGAGG57Selisana et al. (2017)
Avr-Pia_R2GGTATACACGTACGGTAGGG
Avr-PiiAvr-Pii_F1GGTAGATATCCGCTGACTGG57Selisana et al. (2017)
Avr-Pii_R2ACTGTCCGCCGCTCGTTTGG
PWL2PWL2_F1GGTGGCGGGTGGACTAAC60Shi et al. (2018)
PWL2_R2CCTCTTCTCGCTGTTCACGG
ACE1ACE1_F1GTTTATCTACGAGGCTGGGGACATT62Shi et al. (2018)
ACE1_R2GGCGAACGGTAAAATGTAGAAGA

aAnnealing temperature.


결과 및 고찰

북한 접경 지역의 도열병균 단인자 저항성 계통에 대한 반응

북한에서 발생하는 도열병 발생 분포와 자연적으로 발생하는 도열병균의 비병원성 유전자 유무를 알아보기 위하여 북한의 접경지역인 옹진군 백령도, 강원도 고성 그리고 철원, 중국 단둥에 단인자 저항성 계통을 이용하여 밭못자리 검정을 수행하였다. 또한, 남한과 북한 접경지역의 도열병 발생 분포를 비교하기 위하여 남한 내륙지역인 전주와 수원에도 동일한 밭못자리 검정을 수행하였다(Table 1). 총 23개의 도열병 저항성 인자를 가지고 있는 계통들을 밭에 파종하여 재배하였으며, 단인자 저항성 품종들을 가운데 두고 사방으로 도열병균을 쉽게 유도할 수 있는 낙동과 호평 등 감수성 품종들을 심어 도열병 발병에 좋은 조건을 조성 한 뒤 각 지역에서 자연 발생하는 도열병균들의 단인자 저항성 계통에 대한 병 발생 정도를 살펴보았다. 단인자 저항성 계통을 이용한 밭못자리 검정 결과, 남한의 내륙지역인 전주와 수원에서는 대부분의 단인자 저항성 계통들에서 1부터 9까지 다양한 수준의 잎 도열병이 발생하였다. 두 지역에서는 공통적으로 IRBLz-Fu, IRBL7-M, IRBLk-Ka, IRBL1-CL, IRBLi-F5, IRBLa-A, 그리고 IRBLb-B가 7 이상의 감수성 반응을 보였고, IRBL20-IR24, IRBL19-A, IRBLzt-T, 그리고 IRBL9-W가 3 이하의 저항성 반응을 보였다. 특히, 수원에서는 IRBL20-IR24, IRBL19-A에 전혀 도열병이 발생하지 않았는데, 이는 수원에서 자연적으로 발생하는 도열병균이 저항성 유전자 Pi20, Pi19에 상응하는 비병원성 유전자를 가지고 있음을 시사한다. 반면, 북한의 접경지역인 백령도에서는 시험에 사용한 단인자 저항성 계통의 47.8%가 3 이하의 저항성 반응을 보였고, 이 중 IRBL19-A, IRBLta2-PI, IRBLz-Fu, IRBLk-Ka, 그리고 IRBLb-B에서 도열병이 전혀 발생하지 않았다. 이는 백령도에서 자연 발생하는 도열병균이 Pi19, Pita-2, Piz, Pik, Pib에 상응하는 비병원성 유전자를 고루 보유하고 있음을 시사한다. 백령도와 마찬가지로 중국 단둥에서도 시험에 사용한 단인자 저항성 계통 중 47.8%가 3 이하의 저항성 반응을 보였고, 이 중 남한 내륙지역에서 강한 감수성을 보였던 IRBLz-Fu만이 어떠한 도열병 병반도 나타내지 않았다. 이러한 결과로부터 백령도와 중국 단둥이 다른 지역에 비해 비교적 도열병균의 유전적 다양성이 낮아 다수의 단인자 저항성 계통에 저항성 반응을 보인 것으로 유추할 수 있다. 또한, 백령도의 경우 남한 지역이기는 하나 북쪽에 밀접히 위치하여 북한의 황해도 지역과 가까우며 이러한 지리적 차이로 인해 도열병 발생에 있어 남한의 내륙지역과 차이를 보이는 것으로 판단된다. 북한의 접경지역이지만 남한 내륙에 위치한 철원에서는 전주에서와 비슷한 도열병 발생 경향을 보였으나 전주에서와 달리 IRBL20-IR24, IRBLzt-T, IRBL9-W, IRBLsh-B에 전혀 병을 일으키지 못하였다. 특히, IRBLzt-T와 IRBL9-W, IRBLsh-B는 다른 지역과 비교하여 철원에서만 전혀 병이 발생하지 않았는데, 이는 철원에서 자연적으로 발생한 도열병균만이 저항성 유전자 Piz-tPi9, Pish에 상응한 비병원성 유전자를 고루 보유하고 있다고 유추할 수 있다. 또 다른 북한 접경지역인 고성의 경우, 단인자 저항성 계통의 60.9%가 도열병균에 중도저항성 반응을 보였고, 저항성 반응을 보인 5계통 중 IRBL7-M은 남한 내륙지역에서 강한 감수성을 보인 것과 달리 고성에서만 전혀 병이 발생하지 않았다. 한편, 고성에서 발생한 도열병균에 대해 단인자 저항성 계통 IRBLkh-K3과 IRBLb-B은 각각 8의 강한 감수성 반응과 3의 저항성 반응을 보였는데, 이는 고성이 철원과 마찬가지로 남한 내륙에 위치한 북한의 접경지역임에도 병 반응에 있어 남한 내륙지역 및 철원보다는 백령도 및 단둥과 유사하였다. 남한 내륙지역에서 발생한 도열병균은 다양한 병 반응을 일으킨 반면, 북한 접경지역에서 발생한 도열병균은 비교적 단순한 병 반응을 일으켰다고 보이며, 이는 도열병균들의 비병원성 유전자 분포 차이 때문으로 해석된다. 또한 각 계통들의 반응을 고려하여 각 지역에서 유효한 저항성 유전자를 살펴보면, 전주와 수원 등 내륙지역에서는 다수의 저항성 유전자들이 두 지역에 대해 유효하지 않아 높은 이병률을 보인 반면 백령도와 고성 그리고 단둥에서는 3–4개의 저항성 유전자만이 도열병균에 대해 유효하지 않았다. 이는 전주, 수원, 그리고 철원의 경우 도입육종이 활발하여 다양한 저항성 인자들이 육종에 많이 도입되었으며, 그 지역의 도열병균 또한 유전적으로 다양해져 많은 저항성 인자들이 더 이상 효과적이지 않게 된 것으로 추정할 수 있다. 그에 반하여 상대적으로 도입육종이 활발하지 않은 백령도와 고성, 단둥의 경우 아직도 효과적인 저항성 인자들이 많이 있으며 대부분의 비병원성 유전자들이 활성을 유지하고 있음을 알 수 있다. 이러한 결과로 남한에서 발생하는 도열병균의 레이스 분포가 북한에서 발생하는 도열병균의 레이스 분포보다 다양할 것으로 추측해 볼 수 있다.

북한 접경지역에서 분리한 도열병균 레이스 분포

남한 내륙지역과 북한 접경지역에서 발생하는 도열병균의 레이스 분포 차이를 알아보기 위하여 각 지역에서 도열병 병반을 수집하고 각 병반으로부터 단포자를 분리하였다. 총 334개의 단포자 분리한 도열병균을 8개의 판별품종에 접종하여 인디카 품종, 통일계 품종, 자포니카 품종의 병 반응 조합에 따라 레이스를 판별하였다. 각 지역별로 분리한 도열병균들의 KI 레이스와 KJ 레이스 비율을 살펴보면, 전주에서 분리한 균주는 98:2로 대부분이 KI 레이스에 속하였고 백령도와 고성에서 분리한 균주는 각각 1:99와 7:93으로 대부분의 균주가 KJ 레이스에 속하여 남한 내륙지역과 북한 접경지역이 상반된 경향을 보여주었다(Fig. 1). 반면, 남한 내륙지역인 수원과 북한 접경지역인 철원에서 분리한 균주들은 KI 레이스와 KJ 레이스의 비율이 각각 59:41과 54:46으로 비슷하게 나뉘었다. 각 지역의 KI 레이스 및 KJ 레이스 다양성을 비교해보면, 남한의 내륙지역인 전주와 수원에서는 KI 레이스가 각각 12종 및 16종이었고 KJ 레이스가 각각 1종 및 3종으로 나타나 KI 레이스 비율이 월등히 높았던 전주가 수원에 비해 단순한 레이스 분포를 보였고, KI 레이스와 KJ 레이스 비율이 비슷했던 수원에서는 KI 레이스가 비교적 다양하게 나타나는 것을 볼 수 있었다(Fig. 2). 수원과 마찬가지로 KI 레이스와 KJ 레이스 비율이 비슷했던 철원에서는 KI 레이스가 21종, KJ 레이스가 5종으로 나타났으며, 이는 철원이 수원보다 더 다양한 KI 레이스 분포를 가진다는 것을 알 수 있다. 한편, 북한 접경지역인 백령도와 고성에서는 KI 레이스가 각각 1종 및 3종이었고 KJ 레이스가 각각 8종 및 9종으로 나타나 남한 내륙지역에 비하여 매우 단순한 레이스 분포를 보였는데, 이는 1980–90년대에 남한에서 나타난 레이스 분포와 유사한 패턴을 보였다(Han, 1995). 또한, 두 지역에서는 남한 내륙지역에서는 거의 발견되지 않은 KJ-202와 KJ-204, KJ-102, KJ-401, KJ-104, KJ-108, KJ-302, KI-402가 나타났으며, 이는 앞으로 남북한 교류 정상화로 인한 종자 이동 혹은 태풍 등의 자연현상으로 도열병균이 이동하였을 때 남한의 벼에도 피해를 줄 수 있기에 이에 대응하는 저항성 품종 육종을 준비가 필요하다.

Fig. 1.

Ratio of KI race to KJ race at five regions.


Fig. 2.

Proportion of the isolates belonging to KI races and KJ races at five regions.


각 지역에서 우세하게 발생하는 KI 레이스 및 KJ 레이스를 지역별로 살펴보았다(Fig. 3). 전주와 수원에서는 KI 레이스인 KI-101이 각각 24%와 19%로 가장 우세하였고, 수원의 경우 KJ 레 이스인 KJ-101과 KJ-201도 각각 23%와 17%로 우세하게 나타났다. 이와 대조적으로 백령도와 고성에서는 KJ-201이 각각 56%와 51%로 압도적으로 우세하였으나 남한 내륙지역에서 우세하였던 KI-101은 전혀 나타나지 않았다. 한편, 철원에서는 KI-209가 15%로 다섯 지역 중 유일하게 우세하게 나타났고 KJ-201과 KJ-301이 각각 14%와 15%로 비슷한 수준으로 우세하게 나타났다. 이와 같이 지역별로 나타나는 레이스 다양성과 분포 차이는 지리적으로 떨어져 있는 각 지역에서 재배하는 품종의 다양성과 재배환경 차이로 인해 나타났을 수 있다(Han, 1995; Oh 등, 2008; Kim 등, 2016). 한편 1990년대 초, 남한에는 KJ-201과 KJ-301, KJ-105 등 KJ 레이스가 우세하였으나(Han, 1995), 2000년대 이후 KI 레이스가 증가하였다(Han 등, 2001). 특히 Kim 등 (2016)에 의하면 2000년 이후 KI-101은 1% 미만이었으며 2014년까지도 1.6%로 낮은 분포 비율을 보였으나 2015년에 15%로 급증하였다고 보고하였다. 본 연구에서 보고하는 바와 같이 2018년 전주에서는 KI-101이 24%에 달하였고 수원에서도 19%에 달하여 점차 증가하는 추세이다. 앞으로도 KI-101이 계속하여 증가한다면, KI-101이 보유하고 있는 비병원성 유전자를 연구하여 그에 대응하는 저항성원을 통해 저항성 품종 육종을 준비해야 할 것이다.

Fig. 3.

Dominant KI race and KJ race at five regions.


PCR을 이용한 비병원성 유전자 탐색

한국형 판별시스템을 이용하여 각 지역별로 레이스를 확인한 분리 균주들에서 비병원성 유전자 유무를 확인하기 위하여 선행 연구에서 알려진 11개 비병원성 유전자들(Selisana 등, 2017; Shi 등, 2018)에 대한 PCR을 수행하였다. 현재까지 벼에서 알려진 도열병 저항성 유전자와 이에 대응하는 도열병균의 비병원성 유전자가 밝혀진 경우는 Pi-ta/Avr-Pita, Piz-t/AvrPiz-t, Pik/Avr-Pik, Pia/Avr-Pia, Pi-CO39/Avr1-CO39, Pi54/Avr-Pi54, Pii/Avr-Pii, Pi9/Avr-Pi9, Pib/Avr-Pib, Pi33/ACE1 등이 있으며, 그 외 몇몇 비병원성 유전자는 대응하는 저항성 유전자를 찾지 못하였다(Wang 등, 2017). 이미 보고된 논문을 기반으로 11개 비병원성 유전자에 대한 프라이머를 제작하고 PCR을 수행하였다(Table 2). 비병원성 유전자 중 9개 유전자(Avr-Pi9, Avr-Pita1, Avr-Pita2, Avr-Pita3, AvrPiz-t, Avr-Pik, PWL2, ACE1)은 분리한 도열병균에서 최저 92.5%에서 최고 100%로 거의 모든 도열병균이 이 유전자들을 가지고 있었다(Table 3). 그럼에도 불구하고 각 지역에서 수행하였던 도열병균에 대한 저항성 단인자 계통의 병 반응을 보면 매우 다양한 병 반응이 나타난 것을 볼 수 있었다(Table 1). Avr-Pi9AvrPiz-t의 경우, 철원에서 분리한 모든 도열병균이 두 유전자를 가지고 있었고 이에 대응하는 저항성 유전자 Pi9Piz-t가 도입된 IRBL9-W와 IRBLzt-T가 철원에서 전혀 병이 발생하지 않았다. 반면 Avr-Pita2의 경우, 백령도, 고성, 철원에서 분리한 모든 도열병균이 Avr-Pita2를 가지고 있었으나 이에 대응하는 Pita-2가 도입된 IRBLta2-Pi가 세 지역에서 다른 병 반응을 나타냈다. IRBLta2-Pi는 백령도와 고성에서 전혀 병이 발생하지 않았으나 철원에서는 7의 강한 감수성 반응을 보였다. 이와 마찬가지로 AvrPi-k의 경우도 백령도와 수원에서 분리한 대부분의 도열병균이 AvrPik를 가지고 있었으나 이에 대응하는 Pik가 도입된 IRBLk-Ka이 백령도와 수원에서 서로 다른 병 반응을 보였다. IRBLk-Ka는 백령도에서 전혀 병이 발생하지 않은 반면 수원에서는 9의 매우 강한 감수성 반응을 보였다. Avr-PitaAvr-Pikm의 경우도 각각 수원과 철원에서 분리한 대부분의 균주에서 그 존재가 확인되었으나 그에 대응하는 PitaPik-m이 각각 도입된 IRBLta-K1과 IRBLkm-Ts이 수원과 철원에서 7의 강한 감수성 반응을 나타내었다. 앞서 여러 논문에 따르면 비병원성 유전자는 deletion, insertion, point mutations, translocation, gene duplication, transposable elements insertions 등에 의해 변이가 빈번히 발생하며 이로 인하여 저항성 반응이 상실된다고 보고된 바 있다(Chuma 등, 2011; Huang 등, 2014; Longya 등, 2019; Thon 등, 2006; Wu 등, 2015; Zhou 등, 2007). 때문에 이러한 결과는 각 지역에서 자연적으로 발생하는 도열병균의 비병원성 유전자에 변이로 인한 저항성 반응 상실에서 기인한 것이라 생각해볼 수 있겠다. 반면 Avr-PiiAvr-Pia의 경우, 양성 대조군으로 사용한 균주 Ina168에서는 두 유전자가 증폭되어 선명한 밴드가 확인되었으나 백령도에서 분리한 2균주와 철원에서 분리한 2균주를 제외한 모든 균주에서는 어떠한 밴드도 확인되지 않았다. 또한 Avr-PiiAvr-Pia에 대응하는 저항성 유전자 PiiPia이 도입된 품종 IRBLi-F5와 IRBLa-A은 모든 지역에서 감수성 반응을 보였다(Table 1). 즉, 남한 내륙지역과 북한 접경지역에서 분리된 도열병균들은 Avr-PiiAvr-Pia 유전자를 가지고 있지 않다고 추정할 수 있다. Selisana 등(2017)Shi 등(2018)은 비병원성 유전자를 기반으로 한 진단 방법과 단인자 저항성 계통의 병 반응 실험을 통하여 서로 일치하는 결과를 얻었고, 이를 이용하여 지역적으로 또 시기별로 발생하는 도열병균의 집단 분석과 이에 유효한 저항성 유전자를 예측함으로써 도열병 저항성 벼 품종 개발에 유용한 정보를 줄 수 있다고 보고하였다. 그러나 본 연구에서는 지역별로 수행했던 단인자 저항성 계통의 병 반응 결과와 각 지역에서 분리한 균주로부터 PCR을 통해 확인한 비병원성 유전자 유무 결과가 서로 상이하여 비병원성 유전자 분자마커를 이용한 진단 방법으로는 지역별 도열병균 집단 특성과 각 지역에 유효한 저항성 유전자를 예측하기에 부족하였다. 또한, 이와 같은 상이한 결과가 도열병균 간에 비병원성 유전자 변이로부터 기인한 것인지 알기 위하여 앞으로 이들에 대한 염기서열 비교 분석과 각 균주에 대한 단인자 저항성 계통의 병 반응 실험을 수행할 필요가 있다.

Proportion of avirulence genes in the isolates from different locations

LocationNo. of isolatesDistribution of avirulence genes (%)

AVR-Pi9AVR-Pita1AVR-Pita2AVR-Pita3AVRPiz-tAVR-PikAVR-PikmPWL2ACE1AVR-PiiAVR-Pia
Baengnyeongdo96100.0100.0100.099.0100.096.999.099.099.02.10.0
Goseong93100.098.9100.0100.098.998.998.9100.092.50.00.0
Cheorwon85100.0100.0100.098.8100.0100.0100.0100.0100.02.40.0
Suwon6098.398.398.398.398.398.396.798.396.70.00.0

요 약

벼 도열병은 벼를 재배하는 지역에서 가장 중요한 병으로, 벼의 전 생육기에 감염하여 큰 수확량 손실을 초래한다. 우리나라에서는 벼 도열병 방제를 위하여 지속적으로 레이스를 확인하고 저항성 벼 품종을 육성하는 노력을 하고 있다. 북한에서도 벼 도열병은 가장 문제가 되는 곰팡이 병이지만 북한에서 발생하는 도열병균의 레이스 분포를 직접적으로 알기란 매우 어렵다. 본 연구에서는 북한 접경지역에서 도열병 발생 분포를 알아보고 도열병균의 레이스 다양성과 비병원성 유전자 유무를 확인하였다. 단일 저항성 유전자를 도입한 단인자 저항성 계통을 이용하여 남한 내륙지역과 북한 접경지역에서 밭못자리 시험을 수행하였다. 남한 내륙지역인 전주와 수원에서는 도열병균이 단인자 저항성 계통에 다양한 병 반응을 일으킨 데에 반해, 북한 접경지역인 백령도와 중국 단둥에서는 비교적 단순한 병 반응을 보이며 높은 저항성을 보였다. 각 지역에서 분리한 도열병균에 대해 수행한 레이스 판별 결과, 남한 내륙지역과 북한 접경지역의 KI 레이스와 KJ 레이스 비율은 상반되게 나타났으며 남한 내륙지역이 북한 접경지역보다 다양한 레이스 분포를 보였다. 한편, 북한 접경지역에서는 남한 내륙지역에서 발견되지 않은 8개 레이스가 나타나 이에 대한 저항성 품종 육종 대비도 필요하다고 판단된다. 각 지역별로 분리한 대부분 균주에서는 Avr-PiiAvr-Pia를 제외한 9개 비병원성 유전자가 확인되었다. 이는 분리균주가 가지고 있는 비병원성 유전자에 변이로 인하여 병원성이 달라졌다고 판단되며, 추후 비병원성 유전자들에 대한 염기서열 분석과 각 균주에 대한 단인자 저항성 계통의 병 반응을 비교 분석함으로써 각 지역에 유효한 저항성 인자를 찾을 수 있을 것이다.

Acknowledgments

This work was supported by the project PJ012681012019 of National Institute of Crop Science, RDA, Korea.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

References
  1. Bandong, J. M., and Ou, S. H.. 1966. The physiological races of Pyricularia oryzae Cav. in the Philippines. Philipp. Agric. 49: 655-667.
  2. Chuma, I., Isobe, C., Hotta, Y., Ibaragi, K., Futamata, N., and Kusaba, M. et al. 2011. Multiple translocation of the AVR-Pita effector gene among chromosomes of the rice blast fungus Magnaporthe oryzae and related species. PLoS Pathog. 7.
    Pubmed KoreaMed CrossRef
  3. Chung, H., Kang, I. J., Yang, J.-W., Roh, J.-H., Shim, H.-K., and Heu, S.. 2019. Evaluation of disease resistance of rice cultivar developed in North Korea. Res. Plant Dis. 25: 108-113. (In Korean)
  4. Goh, J., Kim, B.-R., Lee, S.-W., Roh, J.-H., Shin, D.-B., and Jeung, J.-U. et al. 2013. Selection of representative Magnaporthe oryzae isolates and rice resistant gene types for screening of blast-resistant rice cultivar. Res. Plant Dis. 19: 243-253. (In Korean)
    CrossRef
  5. Han, S. S.. 1995. Transition of rice blast fungus (Pyricularia grisea) races in relation to differential varieties in Korea. Plant Dis. Agric. 1: 9-17. (In Korean)
  6. Han, S.-S., Ryu, J. D., Shim, H.-S., Lee, S.-W., and Hong, Y.-K.. 2001. Breakdown of resistant cultivars by new race KI-1117a and race distribution of rice blast fungus during 1999-2000 in Korea. Res. Plant Dis. 7: 86-92. (In Korean)
  7. Huang, J., Si, W., Deng, Q., Li, P., and Yang, S.. 2014. Rapid evolution of avirulence genes in rice blast fungus. Magnaporthe oryzae. BMC Genet. 15: 45.
    Pubmed KoreaMed CrossRef
  8. International Rice Research Institute. 1988. Standard Evaluation System for Rice. Los Banos, Philippines.
  9. Kim, Y., Go, J., Kang, I. J., Shim, H.-K., Shin, D. B., and Heu, S. et al. 2016. Distribution of rice blast disease and pathotype analysis in 2014 and 2015 in Korea. Res. Plant Dis. 22: 264-268. (In Korea)
    CrossRef
  10. Kim, Y., Kang, I. J., Shim, H.-K., and Roh, J.-H.. 2017. Pathotype classification of Korean rice blast isolates using monogenic lines for rice blast resistance. Res. Plant Dis. 23: 249-255. (In Korean)
    CrossRef
  11. Lee, E. J., Ryu, J. D., Yeh, W. H., Han, S. S., and Lee, Y. H.. 1987. Proposal of a new method for differentiating pathogenic races of Pyricularia oryzae Cavara in Korea. Res. Rep. RDA (PM & U) 29: 206-213. (In Korean)
  12. Li, Y. B., Wu, C. J., Jiang, G. H., and Wang, L. Q.. 2007. Dynamic analyses of rice blast resistance for the assessment of genetic and environmental effects. Plant Breed. 126: 541-547.
    CrossRef
  13. Longya, A., Chaipanya, C., Franceschetti, M., Maidment, J., Banfield, M. J., and Jantasuriyarat, C.. 2019. Gene duplication and mutation in the emergence of a novel aggressive allele of the AVRPiK effector in the rice blast fungus. Mol. Plant Microbe Interact. 32: 740-749.
    Pubmed CrossRef
  14. Oh, I.-S., Min, J.-Y., Cho, M.-G., Roh, J.-H., Shin, D.-B., and Song, J. et al. 2008. Rice blast control and race diversity by mixed-planting of two cultivars ('Hopyeongbyeo'/'Nampyeongbyeo') with different susceptibility to Magnaporthe oryzae. Res. Plant Dis. 14: 143-152.
    CrossRef
  15. Selisana, S. M., Yanoria, M. J., Quime, B., Chaipanya, C., Lu, G., and Opulencia, R. et al. 2017. Avirulence (AVR) Gene-based diagnosis complements existing pathogen surveillance tools for effective deployment of resistance (R) genes against rice blast disease. Phytopathology 107: 711-720.
    Pubmed CrossRef
  16. Shi, N.-N., Ruan, H.-C., Liu, X.-Z., Yang, X.-J., Dai, Y.-L., and Gan, L. et al. 2018. Virulence structure of Magnaporthe oryzae populations from Fujian province, China. Can. J. Plant Pathol. 40: 542-550.
  17. Thon, M. R., Pan, H., Diener, S., Papalas, J., Taro, A., and Mitchell, T. K. et al. 2006. The role of transposable element clusters in genome evolution and loss of synteny in the rice blast fungus. Magnaporthe oryzae. Genome Biol. 7: R16.
    Pubmed KoreaMed CrossRef
  18. Tsunematsu, H., Yanoria, M. J. T., Ebron, L. A., Hayashi, N., Ando, I., and Kato, H. et al. 2000. Development of monogenic lines of rices for blast resistance. Breed. Sci. 50: 229-234.
    CrossRef
  19. Wang, B.-H., and Ebbole, D. J.. 2017. The arms race between Magnaporthe oryzae and rice: diversity and interaction of Avr and R genes. J. Integr. Agric. 16: 2746-2760.
  20. Wu, J., Kou, Y., Bao, J., Li, Y., Tang, M., and Zhu, X. et al. 2015. Comparative genomics identifies the Magnaporthe oryzae avirulence effector AvrPi9 that triggers Pi9-mediated blast resistance in rice. New Phytol. 206: 1463-1475.
    Pubmed CrossRef
  21. Zhou, E., Jia, Y., Singh, P., Correll, J. C., and Lee, F. N.. 2007. Instability of the Magnaporthe oryzae avirulence gene AVR-Pita alters virulence. Fungal Genet. Biol. 44: 1024-1034.
    Pubmed CrossRef


December 2019, 25 (4)