search for




 

Incidence of Viral Diseases on Solanaceae Crops in Gangwon Province
Res. Plant Dis. 2019;25:22-28
Published online March 31, 2019
© 2019 The Korean Society of Plant Pathology.

Heon-Seop Won1,*, Dong-Kwon Park1, Soon-Bae Kwon1, Sun-Ok Jo1, Sung-Hee Kang1, Jae-Hong Lee1, Se-Jeong Hwang1, Tae-Sung Jeong1, Mi-Kyeong Kim2, Hong-Soo Choi2, and Dae-Ki Hong1

1Division of Agricultural Environment Research, Gangwon-do Agricultural Research and Extension Services. Chuncheon 24226, Korea
2Crop Protection Division, National Academy of Agricultural Science, Rural Development Administration, Wanju 55362, Korea
Tel: +82-33-248-6104
Fax: +82-33-248-6100
E-mail: whs1@korea.kr
Received November 7, 2018; Revised January 3, 2019; Accepted March 11, 2019.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

This study researched the current occurrence status of viral diseases of solanaceous crops in the main production areas of Gangwon region, for four years from 2014 to 2018. From 2014 to 2018, in eight cities and counties including Chuncheon, CMV, BBWV2, PMMoV, TSWV, and PVY occurred in chilli peppers. In case of tomato, the research was performed in 2017 and 2018 while TSWV and TYLCV were verified in Chuncheon, Hoengseong, and Cheorwon. Especially, TYLCV occurred in Chuncheon region for the first time in 2017, which was verified in 2018. Lastly, the current occurrence status of viral diseases of bell peppers was researched in seven cities and counties like Gangneung, Hoengseong, and Cheorwon from 2015 to 2018. In the results, CMV, BBWV2, PMMoV, PepMoV, and TSWV were verified in bell peppers of Gangwon region. During the research period, there were no crops suspected or infected by BWYV, so that it is judged that there is no villiferous or infected aphid by this virus in Gangwon-do. Such results of this study could be used as the basic data for the stable production of crops through the early prevention of plant diseases occurring in the solanaceous crops of Gangwon region.

Keywords : paprika, red pepper, solanaceae crops, tomato, virus
Body

국내 주요 과채류 시설재배면적은 고추, 토마토 등 10 작목에 2017년 38,623 ha이며, 생산량은 1,904,958톤으로 이 중 가지과 작물인 고추, 토마토, 파프리카가 차지하는 비율은 전체 재배면적의 28%, 생산량은 33%이다(농림통계, 2017). 가지과 작물의 강원도 재배면적은 토마토 852 ha, 고추 875 ha, 파프리카 263 ha로 전국 재배면적과 비교해 보면 토마토는 15%, 고추 19%, 파프리카 37%이며, 생산량은 토마토 44,808톤, 고추 30,163톤, 파프리카 23,241톤으로 전국 생산량과 비교하면 토마토 13%, 고추 16%, 파프리카 30%이다. 이런 가지과 작물은 대부분의 시설재배지에서 집약적인 재배를 하고 있으며, 현재 수요증가에 따라 재배면적이 점차 늘어나고 있어 농가의 고소득원으로 중요한 작물이다. 이러한 채소류에 발생하는 바이러스는 총 19종이고, 가장 피해를 많이 주는 바이러스로서 2008년(Kim 등, 2009) 및 2009년(Choi등, 2010)의 경우 Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), Tomato yellow leaf curl virus (TYLCV), Broad bean wilt virus2 (BBWV2) 등 4종을 보고하였다. 2014년부터 2018년까지 강원도 가지과 작물에 가장 많이 발생한 바이러스 역시 Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), Tomato yellow leaf curl virus (TYLCV), Broad bean wilt virus2 (BBWV2)였으며, 토마토반점위조바이러스(TSWV)는 꽃노랑총채벌레(Chatzivassiliou 등, 1999; Jones, 2005; Ullman 등, 1993; Wijkamp와 Peters, 1993; Wijkamp 등, 1993, 1995), 토마토 황화잎말림바이러스(TYLCV)는 담배가루이가 직접 매개하며, 즙액, 종자 및 접촉 전염은 하지 않는다. 최근 기후변화의 영향으로 바이러스를 매개하는 매개충이 증가하고 강원도에서 발생하지 않던 바이러스 병 또한 매년 새롭게 나타나고 있다. 그 예로 토마토 황화잎말림바이러스(TYLCV)는 겨울기온이 낮은 강원도에서는 담배가루이의 월동이 불가능하여 발생하지 않았지만 2017년 춘천지역에 최초로 발생을 하였는데 이는 이상고온 및 가온을 통한 시설재배지의 연중 재배 탓에 성공적으로 월동한 보독충이 살아남아 감염을 일으킨 것으로 판단된다.

강원도 가지과 작물 재배지역에 발생하는 바이러스병의 종류와 발생양상을 파악하는 것은 바이러스병에 의한 피해를 사전에 예방할 수 있는 중요한 기초자료이다. 그러나 강원지역 가지과 작물에 피해를 주는 바이러스의 종류와 병징 발현 특성에 대한 연구가 이루어지지 않아 농업현장에서 쉽게 진단할 수 없었다. 따라서 2014년부터 2018년까지 강원지역 가지과 작물인 토마토, 고추, 파프리카에 발생하는 바이러스의 종류, 병징 및 지역별 분포현황에 대한 조사결과를 보고하고자 한다.

재료 및 방법

조사지역 및 시료 채집.

가지과 작물을 대상으로 고추, 토마토, 파프리카에 발생하는 바이러스의 종류를 조사하기 위해 2014년에 4개 시군(영서: 홍천, 양구; 영동: 인제, 고성)에서 고추 바이러스 의심 주 122점을 채집하였고, 2015년 11개 시군(영서: 춘천, 홍천, 횡성, 철원, 화천, 양구; 영동: 강릉, 속초, 평창, 인제, 고성)에서 고추 131점, 토마토 40점, 파프리카 48점 등 총 219점, 2016년 10개 시군(영서: 춘천, 홍천, 철원, 화천, 양구; 영동: 강릉, 평창, 정선, 인제, 고성)에서 고추 254점, 토마토 22점, 파프리카 66점 등 총 342점, 2017년 7개 시군(영서: 춘천, 횡성, 철원, 양구; 영동: 강릉, 평창, 고성)에서 토마토 95점, 파프리카 119점 등 총 214점, 2018년에 3개 시군(영서: 춘천, 양구; 영동: 강릉)에서 토마토 34점, 파프리카 25점 등 총 59점의 바이러스 의심주 시료를 채집하였다(Table 1-3). 주로 6월부터 9월 사이에 실시하였고 각각의 작물의 잎에 나타나는 바이러스 병징을 육안으로 조사하여 감염이 의심되는 잎을 중심으로 채집하였다(Fig. 1). 각각 포장마다 바이러스 발병정도가 달라 시료 채집수는 일정하지 않았다.

Occurrence of different viruses on pepper in Gangwon province

Region Year Result of RT-PCR

No. of specimens infected CMV BBWV2 PepMoV PMMoV PVY BWYV TSWV
Chuncheon 2015 15 11 9 0 0 0 - 5
2016 46 0 42 18 - - - 34

Gangneung 2015 24 16 22 0 4 0 - 7
2016 53 14 53 9 - - - 42

Sokcho 2015 12 6 6 0 0 0 - 12

Hongcheon 2014 16 10 5 0 1 0 0 -
2015 16 11 13 0 4 1 - 11
2016 38 4 35 5 - - - 29

Pyeongchang 2015 22 13 14 0 6 4 - 14
2016 26 1 23 6 - - - 24

Yanggu 2014 30 29 2 0 0 0 0 -
2015 15 13 10 0 4 0 - 7
2016 27 0 11 3 - - - 13

Inje 2014 45 32 4 0 0 0 0 -
2015 15 13 10 0 4 0 - 7
2016 26 1 18 5 - - - 14

Goseong 2014 31 29 2 0 0 0 0 -
2015 12 5 5 0 4 0 - 4
2016 38 0 38 0 - - - 38

Occurrence of different viruses on tomato in Gangwon province

Region Year Result of RT-PCR

No. of specimens infected ToCV TYLCV TbLCV TSWV TBSV
Chuncheon 2015 18 0 0 0 - -
2016 8 0 0 0 - -
2017 42 0 25 0 0 0
2018 34 0 1 0 31 0

Hoengseong 2017 13 0 0 0 4 0
2018 7 0 0 0 5 0

Cheorwon 2015 6 0 0 0 - -
2016 8 0 0 0 - -
2017 16 0 0 0 14 0

Hwacheon 2015 16 0 0 0 - -
2016 6 0 0 0 - -

Yanggu 2017 24 0 0 0 0 0

Occurrence of different viruses on paprika in Gangwon province

Region Year Result of RT-PCR

No. of specimens infected BWYV CMV BBWV2 PMMoV TSWV PepMoV
Gangneung 2015 16 0 12 12 8 11 -
2016 19 0 0 0 0 12 -
2017 33 0 15 31 - 12 28
2018 6 - 0 3 - 3 0

Hoengseong 2015 12 0 8 7 2 4 -
2016 12 0 8 7 2 4 -

Pyeongchang 2017 28 0 3 0 - 0 0

Jeongseon 2016 6 0 3 3 0 5 -

Cheorwon 2015 20 0 13 12 2 0 -
2016 17 0 0 0 0 14 -

Hwacheon 2016 12 0 0 0 0 0 -

Yanggu 2017 26 0 0 0 - 0 0
2018 19 - 0 17 - 18 0

Goseong 2017 32 0 0 0 - 25 0

Fig. 1.

Morphological characteristics of pepper: CMV(A), BBWV2(B), tomato: TYLCV(C), paprika: TSWV(D).



강원지역 바이러스 분포현황.

2014년부터 2018년까지 강원지역에서 발생한 가지과 작목 바이러스의 종류와 지역별로 어떤 바이러스가 발생했는지를 분석하였다(Fig. 2).

Fig. 2.

Incidence of viral diseases on solanaceae crops in Gangwon province, A: pepper, B: tomato, C: paprika.



유전자 진단.

포장에서 채집된 바이러스 증상시료는 RT-PCR 방법을 이용하여 바이러스를 검정하였다. 우선 채집된 시료를 1.5ml 튜브에 1 cm × 1 cm크기로 자른 후 마쇄한 후 easy-spin™ [DNA free] Total RNA Extraction kit (iNtRON Biotechnology, Seongnam, Korea)를 이용하여 사용자 매뉴얼에 따라 분리를 하였으며 감염 식물체에서 전체 핵산을 분리한 후 핵산 추출물을 진단에 이용하였다. 유전자 진단에 대상 바이러스의 특이 프라이머는 농촌진흥청 국립농업과학원 작물보호과에서 디자인한 프라이머를 사용하였으며, Table 4와 같다. PCR 조성액 총액은 20 μl로 1 × AccuPower® PCR Master Mix (Bioneer, Daejeon, Korea) 2 μl, Forward primer (10 pmol) 1 μl, Reverse primer (10 pmol) 1 μl, RNA 2 μl, D.W 14 μl로 반응시켰다.

Primer sets used for amplification of solanaceae crops virus in this study

Virus Primer name Sequence(5’-3’) Product size
CMV CMV DP u1 CGTCGTGGTTCCCGCTCCG 690 bp
CMV DP d2 AGCGCGCATCGCCGAAAGAT

BBWV2 BBWV2 1-1u AAACAAACAGCTTTCGTTCCG 380 bp
BBWV2 1R GCCATCTCATTGGCATGG A

PepMoV PepMoV u1 AATGGCACGTCCCCAAA 705 bp
PepMoV d1 TCTCTCTCATGCCAACTACGA

PMMoV PMMoV 6F CAGTTTCCAGTGCCAATCAATTA 456 bp
PMMoV 6R GTTGTAGCCCAGGTGAGTCCACTC

PVY PVY N40 GCATACGACATAGGAGAAACTG 550 bp
PVY C10 TATGATAAAAGTAGTACAGG

BWYV BWYV 95F CGAATCTTGAACACAGCAGAG 690 bp
BWYV 784R TGTGGGATCTTGAAGGATAGG

TSWV TSWV 6F GAGATTCTCAGAATTCCCAGT 459 bp
TSWV 6R AGAGCAATCGTGTCAATTTTATTC

ToCV ToCV-M-4F AGAAGATCCGCGCTAATGCTAA 479 bp
ToCV-M-4R GGTCATCTTCCCAAACACGA

TYLCV tylcv 1f GTCAACCAATCAAATTGCATCCTC AA 712 bp
tylcv 1-2r GTCCAAAATCCATTGGGC

TbLCV hyvv 1f GTCAGCCCTAATTTGAACGG 779 bp
hyvv 1r AGCTTGTTCCTTAGACG

TBSV TBSV 2-F AGGTATGTTGACAGGGATGTC 898 bp
TBSV 2-R TTGCCAGGGTACATGGCCCTG


RT-PCR 조건은 55°C에서 30분, 95°C에서 10분 역전사 반응 뒤 95°C에서 10분간 denaturation 후, 95°C에 서 30초, 57°C에서 40초, 72°C에서 45초로 35회로 진행하였고 TbLCV (Tobacco leaf curl virus) 와 TYLCV는 95°C에서 3분간 denaturation 후, 94°C에 서 20초, 55°C에서 30초, 72°C에서 1분로 35회 조건으로 진행하였다. PCR이 완료되면 각 산물은 1.2% agarose gel에서 전기영동을 통해 감염여부를 확인하였다.

결과 및 고찰

고추.

강원지역 고추에서 발생한 바이러스 발생양상 조사를 위해 2014년부터 2016년까지 춘천 등 8개 시군의 고추재배지에서 시료를 채집하였다. 연도별, 지역별 감염률을 보면 2014년에 홍천은 CMV 62.5%, BBWV2 31.3%, PMMoV 6.3%였고, PepMoV, PVY, BWYV는 검출되지 않았다. 양구는 CMV 96.6%, BBWV2 6.6%, PMMoV, PepMoV, PVY, BWYV는 검출되지 않았다. 인제에서는 CMV 71.1%, BBWV2 8.8%였고, 나머지 바이러스는 검출되지 않았으며, 고성은 CMV 93.5%, BBWV2 6.5%였고 인제와 마찬가지로 나머지 바이러스는 검출되지 않았다. 2015년은 CMV 등 6종의 바이러스에 대해 춘천, 강릉 등 8개 지역에서 조사하였다. 진단 결과 춘천은 CMV 73.3%, BBWV2 60%, TSWV 33.3%로 나타났고, PepMoV, PMMoV, PVY는 검출되지 않았다. 강릉지역에서는 CMV 66.6%, BBWV2 91.6%, PMMoV 16.6%, TSWV 29.1%였으며, PepMoV, PVY는 검출되지 않았다. 속초는 CMV 50%, BBWV2 50%, TSWV 100%로 나타났고, PepMoV, PMMoV, PVY는 검출되지 않았다. 홍천은 CMV 68.7%, BBWV2 81.2%, PMMoV 25%, PVY 6.2%, TSWV 68.7%로 나타났고 PepMoV는 검출되지 않았다. 평창에서는 CMV 59.1%, BBWV2 63.6%, PMMoV 27.2%, PVY 18.1%, TSWV 63.6%로 나타났고, PepMoV에 감염된 시료는 없었다. 양구와 인제는 CMV 86.6%, BBWV2 66.6%, PMMoV 26.6%, TSWV 46.6%였으며 PepMoV와 PVY는 검출되지 않았다. 마지막으로 고성에서는 CMV·BBWV2 41.6%, PMMoV․TSWV 33.3%였고 인제와 마찬가지로 PepMoV와 PVY는 검출되지 않았다. 마지막으로 2016년에는 CMV 등 4종의 바이러스에 대해 춘천 등 7개 지역에서 바이러스 감염률을 조사하였다. 그 결과 춘천에서는 BBWV2 91.3%, PepMoV 39.1%, TSWV 73.9%로 나타났고, CMV는 검출되지 않았다. 강릉은 CMV 26.4%, BBWV2 100%, PepMoV 16.9%, TSWV 79.2%로 진단되었으며, 홍천은 CMV 10.5%, BBWV2 92.1%, PepMoV 13.1%, TSWV 76.3%로 나타났다. 평창지역은 CMV 3.8%, BBWV2 88.4%, PepMoV 23%, TSWV 92.3%로 나타났고, 양구에서는 BBWV2 40.7%, PepMoV 11.1%, TSWV 48.1%로 나타났고, CMV에 감염된 시료는 검출되지 않았다. 인제는 CMV 3.8%, BBWV2 69.2%, PepMoV 19.2%, TSWV 53.8%로 나타났으며, 마지막으로 고성은 BBWV2․TSWV 100%의 감염율을 보였고, CMV와 PepMoV는 감염되지 않았다. 일부 지역에서는 검정된 바이러스 수가 전체 검정 수보다 높은 곳이 있는데 이것은 복합감염된 시료가 있기 때문이다(Table 1).

토마토.

토마토에서 발생한 바이러스 발생양상 조사를 위해 2015년부터 2018년까지 춘천 등 5개 시군의 토마토 시설재배지에서 시료를 채집하여 바이러스 검정을 하였다. 연도별 지역별 감염률을 보면 2015년과 2016년에는 춘천, 철원, 화천에서 ToCV 등 3종의 토마토 바이러스에서 대해 검정을 하였는데 3개의 지역 모두 바이러스가 검출되지 않았다. 2017년에는 춘천, 횡성, 철원, 양구에서 ToCV 등 5종의 토마토바이러스에 대한 감염 여부를 조사하였다. 그 결과 양구를 제외한 3개의 지역에서 바이러스가 검출되었다. 첫 번째로 춘천지역에서는 TYLCV 59.5%의 감염률을 보였고 나머지 바이러스는 검출되지 않았다. 횡성은 TSWV 30.7%로 나타났고 ToCV 등 나머지 4종의 바이러스는 발생하지 않았으며 철원도 횡성과 마찬가지로 TSWV 87.5%의 감염율을 보인 반면 다른 바이러스는 진단되지 않았다. 마지막으로 2018년에는 춘천지역에서 TYLCV 2.9%, TSWV 91.1%가 진단되었으며 ToCV, TbLCV, TBSV는 검출되지 않았다. 토마토 바이러스 진단결과를 보면 특히 춘천 지역은 강원도는 겨울기온이 낮아 담배가루이의 월동이 불가능하여 그동안 TYLCV에 의한 감염은 없다고 여겨졌지만 매년 이상고온현상이 지속됨으로 인해 성공적으로 월동한 담배가루이가 주변잡초나 이병주를 흡즙하여 바이러스를 보독한 후 건전주를 감염시켜 2017년에는 강원도에서도 최초 감염이 확인되었다. 2018년에도 감염이 확인되었고 기온은 매년 오르는 만큼 다른 지역으로도 충분히 확산할 가능성이 높으므로 TYLCV에 대한 지속적인 감시가 필요할 것으로 생각된다(Table 2).

파프리카.

강원도 파프리카 시설재배지에서 발생한 바이러스 발생양상 조사를 위해 2015년부터 2018년까지 강릉 등 8개 시군의 시료를 채집하여 바이러스 검정을 하였다. 연도별 지역별 감염률을 살펴보면 2015년에는 강릉, 횡성, 철원에서 BWYV 등 5종의 파프리카 바이러스에서 대해 검정을 하였다. 그 결과 강릉에서는 CMV․BBWV2 75%, PMMoV 50%, TSWV 68.7%의 감염률을 보였다. 횡성에서는 CMV 66.6%, BBWV2 58.3%, PMMoV 16.6%, TSWV 33.3%의 감염률을 보였고 철원에서는 CMV 65%, BBWV2 60%, PMMoV 10%의 감염률을 보이는 것으로 진단되었다. 2016년에는 강릉, 횡성, 정선, 철원, 화천에서 BWYV 등 5종의 파프리카 바이러스에서 대해 검정을 하였는데 화천을 제외한 4개의 지역에서 바이러스가 검출되었다. 첫 번째로 횡성에서는 CMV 66.6%, BBWV2 58.3%, PMMoV 16.6%, TSWV 33.3%의 감염률을 보였으며 2015년과 마찬가지로 BWYV는 검출되지 않았다. 정선지역은 CMV․BBWV2 50%, TSWV 83.3%의 감염률을 보였고 BWYV와 PMMoV는 검출되지 않았다. 강릉과 철원에서는 다른 바이러스는 검출되지 않았고 TSWV만 63.1%, 82.3%의 감염률을 보였다. 2017년에는 강릉, 평창, 양구, 고성에서 BWYV, CMV, BBWV2, TSWV, PepMoV에 대한 바이러스 감염여부를 조사하였는데 양구를 제외한 3지역에서 바이러스가 검출되었다. 강릉에서는 CMV 45.4%, BBWV2 93.9%, TSWV 36.3%, PepMoV 84.8%의 감염률을 보였다. 평창에서는 CMV 10.7%의 감염률만 나타났고, 나머지 바이러스는 검출되지 않았다. 고성에서는 TSWV 78.1%의 감염률만 보였다. 마지막으로 2018년에는 강릉과 양구에서 CMV, BBWV2, TSWV, PepMoV에 대한 바이러스 감염여부를 조사하였는데 강릉은 BBWV2․TSWV 50%의 감염률을 보였고 양구에서는 강릉과 마찬가지로 BBWV2 89.4%, TSWV 94.7%의 감염률을 보였다. 2015년부터 2018년까지 파프리카 바이러스를 진단하는 동안 BWYV에 의한 감염은 없었는데 이 바이러스는 진딧물에 의해 매개되는 바이러스로 아직 강원도에는 BWYV를 매개한 진딧물이 없거나 BWYV에 감염된 이병주가 없는 것으로 판단이 된다(Table 3).

강원지역 바이러스 분포현황.

2014년부터 2018년까지 강원 지역에서 발생한 가지과 작목에 속하는 고추, 토마토, 파프리카의 지역별 바이러스 발생양상에 대한 분석을 하였다(Fig. 2). 고추는 2014년부터 2016년까지 춘천, 강릉, 홍천, 평창, 양구, 인제, 고성에서 바이러스 의심주를 채집하여 유전자 분석을 하였다. 2014년에는 홍천, 양구, 인제, 고성에서 CMV, BBWV2가 발생하였고, 홍천에서는 PMMoV가 추가로 발생하였다. 2015년 조사에서는 춘천, 평창, 속초, 강릉에서도 CMV, BBWV2 가 발생하였으며, 강릉, 평창, 양구, 인제, 고성에서는 PMMoV가 추가로 발생하였으며, 춘천, 속초, 평창, 강릉은 TSWV도 새롭게 확인이 되었다. PVY는 조사기간 동안 유일하게 2015년 홍천, 평창에서만 확인이 되었다. 2016년에는 춘천, 강릉, 홍천, 평창, 인제, 양구에서 PepMoV가 추가로 검출이 되었으며 양구, 인제, 홍천, 고성에서는 TSWV가 추가로 확인이 되었다(Fig. 2A). 토마토는 2017년부터 2018년까지 주산지인 춘천, 횡성, 철원을 조사하여 2017년에는 춘천에서 TYLCV, 횡성․철원은 TSWV가 발생하였다. 2018년에는 춘천에서만 TSWV가 추가로 확인이 되었다(Fig. 2B). 마지막으로 파프리카는 2015년부터 2018년까지 강릉, 횡성, 평창, 정선, 철원, 양구, 고성에서 조사를 하였다. 2015년에는 강릉, 횡성, 철원에서 CMV, BBWV2, PMMoV가 발생하였으며, 강릉, 횡성에서는 TSWV도 추가로 발생하였다. 2016년에는 강릉에서는 PepMoV가 추가로 발생하였으며, 평창에서 CMV, 고성에 TSWV가 신규로 발생하였다. 마지막으로 2018년에는 양구지역에서도 바이러스가 확인이 되었는데 진단 바이러스로는 BBWV2와 TSWV였다. 정선에서 CMV, BBWV2, TSWV가 발생하였으며, 철원에서는 TSWV가 추가로 확인이 되었다(Fig. 2C).

요 약

강원지역 가지과 작물 주산지에서 2014년부터 2018년까지 4년동안 가지과 작물의 바이러스병 발생현황을 조사하였다. 고추에서는 2014년부터 2016년까지 춘천 등 8개 시군에서 CMV, BBWV2, PMMoV, TSWV, PVY가 발생되었다. 토마토는 2017년과 2018년 조사를 실시하였는데 춘천, 횡성, 철원에서 TSWV와 TYLCV가 확인이 되었다. 특히 TYLCV는 2017년 춘천지역에서 최초로 발생되어 2018년에도 확인되었다. 마지막으로 파프리카 발생현황은 2015년부터 2018년까지 강릉, 횡성, 철원 등 7개 시군에서 조사를 실시하였다. 그 결과 강원지역 파프리카에서는 CMV, BBWV2, PMMoV, PepMoV, TSWV가 확인이 되었다. BWYV는 조사기간 동안 의심주 및 감염주 모두 확인되지 않았는데 이는 아직까지 강원도에 이 바이러스에 대한 이병주 및 보독을 한 진딧물이 없는 것으로 판단된다. 이와 같은 연구결과를 통해 강원지역 가지과 작물에 발생하는 바이러스병의 초기 방제로 안정적인 작물생산 과 방제대책 수립자료로 활용될 수 있을 것으로 기대된다.

Acknowledgement

This study was carried out with the support of “Cooperative Research Program for National Institute of Agricultural Sciences (Project No. PJ0101132018)” Rural Development Administration, Republic of Korea.

References
  1. Chatzivassiliou, E. K, Nagata, T, Katis, N. I, and Peters, D. 1999. Transmission of Tomato spotted wilt tospovirus by Thrips tabaci populations originating from leek. Plant Pathol 48: 700-706.
    CrossRef
  2. Choi, H. S, Lee, S. H, Kim, M. K, Kwak, H. R, Kim, J. S, and Cho, J. D et al. 2010. Occurrence of virus diseases on major crops in 2009. Res. Plant Dis 16: 1-9. (In Korean)
    CrossRef
  3. Jones, D. R. 2005. Plant viruses transmitted by thrips. Eur. J. Plant Pathol 113: 119-157.
    CrossRef
  4. Kim, J. S, Lee, S. H, Choi, H. S, Kim, M. K, Kwak, H. R, and Cho, J. D et al. 2009. Occurrence of virus diseases on major crops in 2008. Res. Plant Dis 15: 1-7. (In Korean)
    CrossRef
  5. Ullman, D. E, German, T. L, Sherwood, J. L, Westcot, D. M, and Cantone, F. A. 1993. Tospovirus replication in insect vector cells:Immunocytochemical evidence that the nonstructural protein encoded by the S RNA of Tomato spotted wilt tospovirus is present in thrips vector cells. Phytopathology 83: 456-463.
    CrossRef
  6. Wijkamp, I, and Peters, D. 1993. Determination of the median latent period of two tospoviruses in Frankliniella occidentalis using a novel leaf disk assay. Phytopathology 82: 986-991.
    CrossRef
  7. Wijkamp, I, Van Lent, J, Kormelink, R, Goldbach, R, and Peters, D. 1993. Multiplication of Tomato spotted wilt virus in its insect vector, Frankliniella occidentalis. J. Gen. Virol 74: 341-349.
    Pubmed CrossRef
  8. Wijkamp, I, Almarza, N, Goldbach, R, and Peters, D. 1995. Distinct levels of specificity in thrips transmission of tospoviruses. Phytopathology 85: 1069-1074.
    CrossRef


March 2019, 25 (1)