search for




 

Occurrence and eradication of Plum pox virus on Ornamentals in Korea, 2016-2017
Res. Plant Dis. 2019;25:8-15
Published online March 31, 2019
© 2019 The Korean Society of Plant Pathology.

Mikyeong Kim1,† , Gi-Su Kim2,†, Hae-Ryun Kwak1, Jeong-Eun Kim1, Jang-Kyun Seo3, Seong-Jun Hong4, Gyeong-Jae Lee4, Ju-Hui Kim5, Min-Kyeong Choi5, Byeong-Ryeon Kim6, Ji-Gwang Kim6, In-Yeong Han7, Hyeon-Ju Lee8, Heon-Seop Won9, Hyo-Jung Kang10, Jong-Woo Han10, Suk-Ju Ko11, Hyo-Jeong Kim11, Seung-Han Kim12, Jung-Hywan Lee12, and Hong-Soo Choi1,*

1Crop Protection Division, National Institute of Agricultural Science, Wanju 55365, Korea
2Department of Central Area Crop Science, National Institute of Crop Science, Wanju 55365, Korea
3Graduate School of International Agricultural Technology, Seoul National University, Pyeongchang 25354, Korea
4Extension Service Bureau, Rural Development Administration, Jeongju 54875, Korea.
5Jeollabuk-do Agricultural Research and Extension Services, Iksan 54591, Korea
6Chungcheongnam-do Agricultural Research and Extension Services, Yesan 32418, Korea
7Gyeongsangnam-do Agricultural Reasarch and Extension Services, JinJu, 52733, Korea
8Gyeonggi-do Agricultural Research and Extension Services, Hwasung 18388, Korea
9Gangwon-do Agricultural Research and Extension Services, Chuncheon 24226, Korea
10Chungcheongbuk-do Agricultural Research and Extension Services, Boeun 28902, Korea
11Jeollanam-do Agricultural Research and Extension Services, Naju 58213, Korea
12Gyeongsangbuk-do Agricultural Research and Extension Services, Daegu 41401, Korea
Tel: +82-63-238-3300 Fax: +82-63-238-3838 E-mail: hschoi@korea.kr
Received November 17, 2018; Revised February 9, 2019; Accepted March 11, 2019.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Plum pox virus (PPV) is a significant viral disease in Prunus spp. worldwide. A nationwide survey was started in Prunus spp. orchards, since PPV was first detected from peach in Korea, 2015. During 2016-2017, samples were collected from 30,333 trees in 1,985 orchards of stone fruits in 8 provinces and 4 cities, Korea and tested by RTPCR using specific PPV primer set. As a result, 21 trees including peach (9 trees), Japanese apricot (4 trees), plum (1 tree), apricot (7 trees) in 10 orchards were infected and controlled by eradication program. Amplicons of the expected size (547 bp) were obtained from total RNA of seven peach trees in 2016, and directly sequenced. BLAST analysis revealed the highest nucleotide (NT) identity (99%) with a PPV D isolates (LC331298, LT600782) in Genbank. The seven isolates from shared nt sequence identities of 98 to 100% with one another. Phylogenetic analysis showed the isolates in peach clustered closely with the PPV-D isolates from Korea, Japan, USA, and Canada. This is, to our knowledge, the first report of the presence of PPV in Prunus spp. orchards in Korea, 2016-2017, we hope that our results and efforts will contribute to effective measures for eradication of PPV.

Keywords : Eradication, Detection, Plum pox virus, Sharka, Stone fruits
서 론

자두곰보병은 핵과류의 잎과 과일에 괴저, 심한 모자이크, 원형반점 증상을 일으키는 병으로 자두곰보바이러스(Plum pox virus, PPV)에 의해 발생된다. 자두곰보병은 식물 바이러스병으론 국내 유일 검역 금지급 병이며(Shin과 Lee, 2013), 기후 품종, 바이러스 발생 계통 등에 따라 75-100% 수확량이 감소한다고 보고되었다(Cambra 등, 2006; Dunez와 Sutic, 1998; García 등, 2014; Németh, 1994). 자두곰보병은 1915년 불가리아의 자두에서 처음 확인이 되었으며(Atanasoff, 1932), 발생현황을 보면 1950-1970년대 유럽 전 지역(Llácer와 Cambra, 1998; Roy와 Smith 등, 1994)과 지중해 연안 아프리카를 시작으로 1990년대 남미의 칠레, 북미의 미국과 캐나다로 확산(Gottwald, 2006; Levy 등 2000; Reyes 등, 2003; Rosales 등, 1998) 되었고, 2004년에 중국(Navratil 등, 2005), 2009년에 일본에서 처음 보고되었다(Maejima 등, 2010). 2014년 전후로는 세계적으로 약 50개국에서 발생하고 있다.

자두곰보바이러스(PPV)는 660–770 nm 사상형의 single stranded RNA 바이러스로 Potyvirus 과에 속하며(Adams 등, 2011; Lopez-Moya 등, 1999), 주로 조팝나무진딧물, 복숭아혹 진딧물 등 20종의 진딧물에 의한 비영속 전염 및 바이러스에 감염된 대목 또는 접수를 통해 전염이 된다고 보고되었다(Fereres와 Moreno, 2009; Goytia 등, 2006; Lopez-Moya 등, 1995). 자두곰보바이러스는 혈청학적 및 분자학적으로 지금까지 9개 계통(D, M, Rec, EA, C, T, W, CR, An)이 보고되었으며(Glasa 등, 2013), 그 중 D (Dideron) 계통은 세계적으로 가장 많이 발생하는 계통으로 진딧물, 접목 전염이 되며, 확산 속도 느린 것으로 보고되었다(Dallot 등, 1998; Damsteegt 등, 2007; Labonne 등, 1994). M (Marcus) 계통은 유럽, 캐나다 그리고 2016년 일본 매실에서 발생하는 것으로 보고되었으며(Oishi 등, 2018), 진딧물, 접목, 즙액, 종자전염이 되고, 확산 속도가 빠른 것으로 보고되었다(Candresse 등, 1993). 그 외에 D 계통과 M 계통의 재조합 Rec 계통(Glasa 등, 2002), C (Cherry), CR 체리에 발생되는 계통 등이 보고되었다(Glasa 등, 2013).

유럽에서는 지난 30년 동안 자두곰보병 확산 방지를 위하여 약 1억 주의 나무가 제거되었고, 10억 유로(1조 2000억원) 피해가 추정되어 유럽에서 가장 많은 경제적 피해가 나타난 것으로 보고되었다(Cambra 등, 2006; Mumford, 2006; Myrta 등, 2006; Ramel 등, 2006; Speich, 2006). 미국 펜실베이니아 주의 경우 2000-2006년 D 계통의 자두곰보바이러스 발생에 의해 나무 2,595주가 제거되었고, 29백만 달러(330억원)의 비용 손실이 나타난 것으로 보고되었다(Redding, 2010). 일본의 경우 2009년 오메시 매실(D 계통)에서 처음 알려졌으며, 진딧물과 감염 접수로 확산된 것을 확인하였고, 2010년 우메 매화공원으로 확산되어 100주 이상 제거, 2009-2012년까지 약 2,600주를 제거하였지만 박멸되지 않았다. 2013년 일본 농림수산성은 바이러스 근절을 위해 감염 주뿐만 아니라 주변 나무까지도 제거하기로 결정하였다. 자두곰보바이러스 발생 조사 후 현재 방제지역 추가 등 바이러스 방제가 진행 중에 있다(Tsuda 와 Sano, 2014).

2015년 경북 농업기술원 청도복숭아시험장(현 청도복숭아 연구소)의 복숭아에서 국내 최초 자두곰보바이러스(D 계통) 감염이 확인된 이후(Oh 등 2017), 국내 자두곰보병 박멸을 위한 핵과류 과원을 대상으로 자두곰보병 발생 상황 조사가 시작되었다. 본 연구는 국내 복숭아, 매실 등 핵과류 과원의 자두곰보 바이러스 감염 여부를 조사하고, 이를 바탕으로 발생 주 제거 등 국내 금지급 자두곰보병의 예방 및 방제 대책 수립을 위한 기초자료로 활용하고자 하였다.

재료 및 방법

바이러스 조사.

2016년 6월 경북 청도군 복숭아 과원에서의 금지병원체 의심시료 발견에 따라 청도군 지역의 복숭아 4과원(이서면 2과원, 화양읍 2과원)의 전수 나무에 대해 자두곰보병 발생 여부를 조사하였다. 또한 우리나라 핵과류 과원을 대상으로 국내 자두곰보병 발생 조사 및 발생 시 방제를 위해 국립농업과학원을 포함한 농촌진흥청, 각 시군 센터를 포함한 도농업기술원 협업으로 2016년 7월 8개 도의 총 869과원(경기도 101과원, 강원도 100과원, 충북 100과원, 충남 101과원, 전북 100과원, 전남 94과원, 경북 172과원, 경남 101과원), 2017년 6월 8개 도와 4개 특별자치시 및 광역시의 총 1,146과원(경기도 100과원, 강원 100과원, 충북 189과원, 충남 90과원, 전북 105과원, 전남 180과원, 경북 180과원, 경남 102과원, 대전 25과원, 세종 30과원, 광주 20과원, 대전 25과원)에 대해 표본조사 하였다(Table 1-2).

Sample surveys conducted in Prunus spp. orchard in Korea for Plum pox virus, 2016

No of sites / samples a (trees)

Peach Japanese apricot Plum Cherry Total
Gyeonggi-do 68/203 (1,015) 25/75 (375) 8/22 (110) 101/300 (1,500)
Gangwon-do 93/257 (1,285) 2/6 (30) 5/15 (75) 100/278 (1,390)
Chungcheongbuk-do 85/255 (1,275) 6/18 (90) 9/27 (135) 100/300 (1,500)
Chungcheongnam-do 54/162 (810) 44/132 (660) 3/9 (45) 101/303 (1,515)
Jeollabuk-do 55/165 (825) 26/78 (390) 15/45 (225) 4/12 (60) 100/300 (1,500)
Jellanam-do 32/101 (505) 57/183 (915) 5/15 (75) 94/299 (1,495)
Gyeongsangbuk-do 134/402 (2,010) 38/114 (570) 172/516 (2,580)
Gyeongsannam-do 36/107 (535) 59/177 (885) 6/16 (80) 101/300 (1,500)

Total 557/1,652 (8,260) 219/669 (3,345) 89/263 (1,315) 4/12 (60) 869/2,596 (12,980)
Number of samples collected from five trees of each species.

Sample surveys conducted in Prunus spp. orchard in Korea for Plum pox virus, 2017

No of sites / samples a (trees)

Peach Japanese apricot Plum Apricot Cherry Plumcot Total
Gyeonggi-do 71/71 (1,065) 20/20 (300) 9/9 (135) 100/100 (1,500)
Gangwon-do 92/92 (1,380) 4/4 (60) 4/4 (60) 100/100 (1,500)
Chung cheongbuk- do 174/174 (2,610) 7/7 (105) 8/8 (120) 189/189 (2,835)
Chung cheong- nam-do 52/52 (780) 33/33 (495) 5/5 (75) 90/90 (1,350)
Jeollabuk-do 82/82 (1,230) 3/3 (45) 11/11 (165) 1/1 (15) 8/8 (120) 105/105 (1,575)
Jellanam-do 37/37 (555) 130/130 (1,950) 12/12 (180) 1/1 (15) 180/180 (2,700)
Gyeongsangbuk-do 91/91 (1,365) 1/1 (15) 84/84 (1,260) 4/4 (60) 180/180 (2,700)
Gyeongsannam-do 32/32 (480) 59/59 (885) 11/11 (165) 102/102 (1,530)
Daejeon-si 25/25 (375) 25/25 (375)
Sejong-si 30/30 (450) 30/30 (450)
Gwangju-si 16/16 (240) 2/2 (30) 2/2 (30) 20/20 (300)
Daegu-si 9/9 (135) 4/4 (60) 12/12 (180) 25/25 (375)

Total 711/711 (10,665) 259/259 3,885 150/150 (2,250) 17/17 (255) 8/8 (120) 1/1 (15) 1,146/1,146 (17,190)
Number of samples collected from fifteen trees of each species.


시료 채집.

경북 청도군 복숭아 4과원의 555주 나무에서 나무 당 3잎 이상씩, 그리고 과실이 있는 경우 과실을 포함하여 115점, 246점, 163점, 31점, 총 555점의 시료를 수집하였다.

전국의 핵과류 과원 조사의 경우 8개 도, 1개 특별자치시, 3개 광역시의 핵과류 과원의 시료 채집은 과원 당 자두곰보병 의심 증상을 보이는 포장에서 양끝 열, 중간 열 총 3열이 조사되었다. 이상 증상 등을 고려하여 열 당 5주의 나무를 선정하고, 각 나무의 서로 다른 2개의 가지에서 각 1잎씩을 채집하였다. 2016년에는 열에서 10잎(5주)을 한 봉투에 담아 각 열 당 1점으로 과원 당 3점을 채집하였고, 복숭아 557과원의 8,260주 나무에서 1,652점, 매실 219과원의 3,345주 나무에서 669점, 자두 89과원의 1,315주 나무에서 263점, 체리 4과원의 60주 나무에서 12점이 수집되어 총 869 과원의 12,980주 나무에서 5주씩 묶음으로 하여 총 2,596점의 시료를 수집하였다(Table 1). 2017년에는 열에서 10잎 씩 3열에서 30잎(15주)을 한 봉투에 담아 과원당 1점을 채집하여, 8개 도, 4개 특별자치시 및 광역시의 복숭아 711과원의 10,665주 나무에서 711점, 매실 259과원의 3,885주 나무에서 259점, 자두 150과원의 2,250주 나무에서 150점, 살구 17과원의 255주 나무에서 17점, 체리 8과원의 120주 나무에서 8점, 플럼코트 1과원의 15주 나무에서 1점이 수집되어 총 1,146과원의 17,190주 나무에서 15주 묶음으로 총 1,146점의 시료를 수집하였다(Table 2).

1차 묶음 시료에 대한 자두곰보바이러스 유전자 검정 결과 양성인 경우 나무별 개별 검정을 위하여 자두곰보병 의심 나무의 사방 가지에서 2잎 이상씩 총 8잎 이상을 채집하였다. 2차 나무 개별에 대한 자두곰보병 검정 결과 양성인 경우, 자두곰보바이러스 감염 나무 주변 사방 8주의 나무에서 2차 개별 시료 채집과 동일한 방법으로 추가 시료를 채집하였다.

전체 RNA 추출 및 RT-PCR 진단.

자두곰보바이러스 유전자 진단을 위하여 수집된 핵과류 10잎 또는 30잎에서 1.5 microtube 뚜껑(대략 15 mg)으로 의심 증상을 보이는 부분을 포함한 잎 당 3부위의 잎을 혼합한 후, 액체질소를 이용하여 막자와 막자사발로 마쇄하였다. Biocube를 이용한 게놈 추출 키트(BCS FP Kit, Biocubesystem Co.)를 이용하여 Total RNA를 추출하였으며, 추출된 Total RNA은 본 연구에서 제작된 자두곰보바이러스 coat protein 영역을 포함한 모든 계통을 진단할 수 있는 특이 프라이머 PPV-Det-Fw2 (5’ CAAGTGGAGTATCCAATAAAGCCATTG 3’), PPV-R (5’ CAAGGGCCTGTGTTCGACAATAA 3’)를 이용하여 Genetbio SuPrimeScript RT-PCR 2X Premix로 one step RT-PCR를 수행하였다. RT-PCR 조건은 50°C 30분, 95°C 5분, <95°C 30초, 50°C 30초, 72°C 1분>으로 40 cycle, 72°C 5분을 실시하여 바이러스를 진단하였다. 전기영동은 1X TBE buffer와 1% agarose gel에서 실시하였고, 분자량 마커로 100 bp DNA ladder를 이용하였다. 각각의 PCR 증폭 산물은 100 V에서 60분간 전기영동 후 UV transilluminator를 이용하여 결과를 확인하였다. 위와 같은 방법으로 8개 도원에서 수집된 1차 묶음 시료는 각 도 농업기술원에서 진단하였고, 경북 청도군 복숭아 4과원 시료, 광역시 및 세종특별자치 시료, 나무 개별로 채집된 시료는 농촌진흥청 국립농업과학원 작물보호과에서 진단하였다.

계통 분석.

RT-PCR 결과 자두곰보바이러스 양성인 시료에서 약 547 bp PCR 산물을 정제 후 direct sequencing을 통하여 염기서열을 결정하였고, 미국국립생물정보센터(National Center for Biotechnology Information, NCBI)의 BLAST 분석 및 유연관계를 분석하였다.

결과 및 고찰

2016년 자두곰보병 조사.

2016년 6월 농림축산검역본부의 자두곰보병 발생 의심 농가 알림에 따른 육안 및 유전자 검정을 통한 경북 청도군 복숭아 4과원 555주 나무에 대한 전수조사를 하였다. 자두곰보바이러스 감염 현황을 조사하기 위하여 총 555점을 채집하여 유전자 진단을 실시한 결과, 복숭아 2과원의 각 1주의 나무에서 자두곰보바이러스 감염을 확인하였다(Table 3).

Incidence of Plum pox virus in Prunus spp. in Korea, 2016 – 2017

Host plant Complete enumeration Sample survey

2016 2016 2017

Sample collected / RT-PCR positive

sites trees sites trees sites trees
Peach 4/2 555/2 557/3 8,297/5 711/1 10,681/2
Japanese apricot 219/2 3,365/4 231/0 3,465/0
Plum 89/0 1,316/0 144/1 2,168/1
Apricot 4/0 60/0 17/1 286/7
Cherry 8/0 120/0
Plumcot 1/0 15/0
Chines wild peach 5/0

Total 4/2 555/2 869/5 13,038/9 1,112/3 16,740/10


전국 핵과류 과원을 대상으로 국내 자두곰보바이러스 감염 현황을 조사하기 위해 2016년 8개 도 869과원의 12,980주 나무에서 2,596점의 시료를 수집하였다. 수집된 묶음 시료에 대한 자두곰보바이러스 유전자 검정을 실시한 결과, 13과원의 14점(복숭아, 매실 각각 7점) 시료에서 자두곰보바이러스 양성반응을 보였다. 나무별 개별 검정을 위하여 복숭아 7과원(경기 2과원, 충남 2과원, 전북 2과원, 경남 1과원)의 59주, 매실 6과원(경기 1과원, 충남 13과원, 전북 3과원, 경남 1과원)의 59주까지 총 13과원에서 118주 나무에 이상 증상을 보이는 잎 시료를 수집하여 유전자 검정을 실시하였다. 그 결과 복숭아 3과원(충남 2과원, 전북 1과원)의 4주, 매실 2과원(전북 1 과원, 경남 1 과원)의 3주, 총 핵과류 5과원 7주에서 자두곰보바이러스 감염을 확인하였다. 개별 검정을 통한 핵과류 7주의 자두곰보바이러스 감염 확정에 따라 감염 주 주변 8주, 총 50주(충남 2과원 - 복숭아 24주, 전북 2과원 - 복숭아 7주, 매실 8주, 경남 1과원 - 매실 4주, 복숭아 6주, 자두 1주)에서 대한 추가적인 시료를 채집하였다. 충남 복숭아 과원의 경우 잎과 과실이 있는 경우 추가로 과실을 채집하여 검정하였다. 전북 복숭아 과원의 경우 주변에 8주의 나무가 존재하지 않아 7주의 나무만 채집되었고, 매실과원의 경우 잎이 남아 있지 않아 줄기를 채집하여 검정하였다. 경남 매실 과원 역시 주변의 8주의 나무가 존재하지 않아 매실, 복숭아, 자두 총 11주를 채집하여 검정하였다. 그 결과 복숭아 1주(충남 1과원), 매실 1과원(전북 1과원) 총 2주에서 추가로 자두곰보바이러스 감염을 확인하였다. 그 후 충남 복숭아 과원은 개별 및 추가 검정을 통해 전수가 조사되어 추가적인 조사를 하지 않았다. 전북 매실 과원의 경우 추가로 감염이 확인된 매실나무 주변 매실 8주에 대한 줄기 시료를 채집하여 자두곰보바이러스 유전자 진단을 한 결과, 추가적인 감염은 확인되지 않았다. 8개 도에서 총 869과원에 대한 1차 묶음, 개별 검정(12,980주), 2번의 주변 나무 검정(58주) 총 13,038주 나무에 대한 자두곰보바이러스 감염 조사 결과, 복숭아 3과원의 5주, 매실 2과원의 4주, 총 핵과류 5과원 9주에서 자두곰보바이러스 감염을 확인하였다. 2016년 경북 이서면 복숭아 4과원의 전수조사 및 전국 핵과류 869과원을 대상으로 표본조사 한 결과 총 7과원 11주(복숭아 7주, 매실 4주)에서 자두곰보바이러스 감염을 최종 확인하였다.(Table 3).

2017년 자두곰보병 조사.

전국 핵과류 과원을 대상으로 2017년 국내 자두곰보바이러스 감염 현황을 조사하기 위해 2016년 조사와 비교하여 핵과류 재배면적이 넓은 충북 (189과원), 전남 (180과원), 경북 (180과원) 지역의 조사 과원이 늘어났고, 4개 특별자치 시 및 광역시의 핵과류 과원이 추가되었다(Table 2). 총 1,146과원의 17,190주 나무에서 1,146점의 시료를 수집하였다. 이 중 시료 보관 중에 문제로 매실 28과원(420주, 28점), 자두 6과원 (90주, 6점) 총 34과원의 510주에서 수집된 시료 34점이 폐기되어 1,112과원의 16,680주 나무에서 1,112점의 수집된 묶음 시료에 대한 자두곰보바이러스 유전자 진단을 실시하였다. 그 결과, 6과원의 6점(복숭아 4점, 자두, 살구 각각 1점) 시료에서 자두곰보바이러스의 양성반응을 보였다. 나무별개별 검정을 위하여 복숭아 4과원(전북 4과원)의 60주, 자두 1과원(전북 1과원)의 15주, 살구 1과원 (전북 1과원)의 15주, 총 6과원에서 90주 나무에 이상 증상을 보이는 잎 시료를 수집하여 유전자 검정을 실시하였다. 그 결과 복숭아 1과원(전북 1과원)의 2주, 자두 1과원(전북 1과원)의 1주, 살구 1과원(전북 1과원)의 3주, 총 핵과류 3과원 6주에서 자두곰보바이러스 감염을 확인하였다. 개별 검정을 통한 핵과류 6주의 자두곰보바이러스 감염 확정에 따라 감염 주 주변 8주, 총 48주(전북 3과원 - 복숭아 16주, 자두 8주, 살구 24주)에서 대한 추가적인 시료를 수집하였다. 그 결과 살구 4주(전북 1과원)에서 추가로 자두곰보바이러스 감염을 확인하였다. 추가로 자두곰보바이러스 감염이 확인된 살구 과원의 경우 개별 및 추가 검정(39주) 후 남은 전수인 살구 7주 및 개복숭아 5주, 총 12주에서 시료를 추가로 채집하여 검정하였고, 추가적인 감염은 확인되지 않았다. 전국 핵과류 과원을 대상으로 2017년 6월 8개 도, 4개 특별자치시 및 광역시의 총 1,112과원에 대한 1차 묶음, 개별 검정 (16,680주), 2번의 주변 나무 검정(60주) 총 16,740주 나무에 대한 자두곰보바이러스 감염 조사 결과, 복숭아 1과원의 2주, 자두 1과원의 1주, 살구 1과원의 7주, 총 핵과류 3과원 10주에서 자두곰보바이러스 감염을 확인하였다(Table 3).

핵과류 과원의 자두곰보병 발생.

국내 유일 검역 금지급 바이러스병인 자두곰보병이 2015년 9월 국내 복숭아에서 보고됨에 따라(Oh 등, 2017), 2015년 10월 8개 도 16지역의 핵과류 과원에서 793점, 첫 발생지 인근 핵과류 과원에서 500점의 시료를 채집하여 자두곰보바이러스 진단 특이 프라이머를 이용하여 유전자 검정 한 결과 자두곰보바이러스 감염은 확인되지 않았다(미보고). 국내 식물방역법 제31조 등에 따라 국내 핵과류 과수원에 피해가 우려되는 자두곰보병의 조기 박멸과 국내 자 두곰보바이러스 감염 상황 조사를 위한 조사 지역, 시료 채취 및 검정 방법, 방제 등을 포함한 확산방지 전문가 회의, 워크숍 등이 개최되었다. 2016-2017년 6–7월경, 국립농업과학원을 포함한 농촌진흥청과 각 시·군 농업기술센터를 포함한 도 농업기술원의 협업으로 국내 핵과류 2,019과원에 대한 육안조사를 실시한 결과, 황화, 퇴록, 모자이크 등의 이상 증상은 관찰할 수 있었으나 원형 반점 등 자두곰보병의 뚜렷한 증상은 관찰되지 않았다. 자두곰보바이러스에 감염된 살구속 핵과류는 잎, 과실, 씨 표면의 원형 반점, 퇴록 반점, 엽맥 퇴록, 황화, 괴저, 모자이크 등 증상이 나타나며, 이러한 증상은 나무의 상태, 기후, 품종, 바이러스 발생 계통에 따라 많은 차이를 보인다고 보고되었다(Dunez와 Sutic, 1988; James 등, 2013). 세계적으로 22여 종의 바이러스가 복숭아에 발생하는 것으로 보고되었으며(Fauquet 등, 2005), 그 중 Apple chlorotic leaf spot virus (ACLSV), Prunus necrotic ringspot virus (PNRSV) 등 7종이 단독, 혹은 복합적으로 발생하여 과수 수세를 약화시킨다고 보고되었다(Cho 등, 2012; Lim 등, 2015). 따라서 정확한 자두곰보병 발생 조사를 위해 2016년 경북 청도군 복숭아 과원의 전수조사 및 2016–2017년 8개 도, 4개 특별자치시 및 광역시의 표본조사를 통해 국내 핵과류 1,985과원의 30,333주 나무에 시료를 수집하여 자두곰보바이러스 감염 조사를 한 결과, 4개 도 5개 시·군의 10과원 21주(충남 2과원 – 복숭아 4주, 전북 5과원 – 복숭아 3주, 매실 2주, 자두 1주, 살구 7주, 경북 2과원 – 복숭아 2주, 경남 1과원 – 매실 2주)에서 자두곰보바이러스 감염을 확인하였으며, 박멸조치에 따라 감염 주에 대한 폐기 등 방제가 실시되었다(Fig. 1).

Fig. 1.

Map of Plum pox virus (PPV) incidence in South Korea, 2016- 2017. Dots (area, host, no of tree) indicates occurrence of the PPV characterized in this study. CG, Chungcheongnam-do geumsangun; JG, Jeollabuk-do gunsan-si; JB, Jeollabuk-do buan-gun; GC, Gyeongsangbuk-do cheongdo-gun; GJ, Gyeongsangnam-do Jinju- si.



계통 분석.

자두곰보바이러스 감염이 확인된 시료 중 2016년 복숭아 7점에 대한 PCR 산물을 정제 후 양방향의 direct sequencing (Genotech, Daejeon, Korea)을 통하여 평균 500 bp 정도의 염기서열을 결정하였다. 미국국립생물정보센터 (National Center for Biotechnology Information, NCBI)의 BLAST 검색 결과, Genbank에 등록된 자두곰보바이러스 D 계통 분리 주들과 99% 염기서열 상동성을 보였다. 계통학적 유연관계를 분석하기 위하여 Geneious 8.1.9. 프로그램의 ClustalW, PHYML(K80, Bootstrap 100)을 사용하였고, 기존에 보고된 자두곰보바이러스 주요 계통인 D, M, Rec를 포함한 6계통 13개 분리 주와 비교 분석하였다. 2016년 국내 발생 자두곰보바이러스 분리 주 간에 98–100% 높은 염기서열 상동성을 보였고, 기존에 보고된 D 계통 복숭아 분리주(LC159485, 한국(2015), 복숭아), Ou1 분리주 (AB109100, 일본, 매실), PENN1 분리주(AF401295, 미국, 복숭아), Vulcan 분리주(AY912057, 캐나다, 복숭아)와는 95-100% 상동성을 보였다. M 계통의 경우 89–94 %, Rec 계통은 88–94 % 상동성을 보였다. Phylogenetic tree 분석을 통한 13개 분리 주와 유연관계를 분석한 결과, D 계통과 높은 유연관계를 가지는 것을 확인할 수 있었다(Fig. 2).

Fig. 2.

Phylogenetic analysis by Maximum likelihood (ML) method showing the relationship of Plum pox virus (PPV) isolates from countries based on an alignment of nucleotide sequences. ML phylogeny reconstructed using simultaneous NNI moves. The log-likelihood of the corresponding phylogenetic model is –40594.32868. Numbers in the tree correspond to non-parametric bootstrap supports (100) replicates.



본 연구는 2016-2017년 국내 복숭아, 매실 등 핵과류 과원의 자두곰보바이러스 감염 여부를 조사하고, 이를 바탕으로 국내 자두곰보병 박멸을 위한 발생 주 제거 등 예방 및 방제 대책 수립을 위한 기초자료로 활용하고자 수행되었다. 현재까지 국내에 보고된 D 계통은 즙액접종이 잘 되지 않으며, 진딧물에 의한 확산이 더딘 계통으로 알려져 있으나 자두곰보바이러스는 계통 간의 재조합(Rec 계통; D, M 재조합), 계통 안에서의 변이 발생 가능성이 높아 발생 시 위험한 병으로 알려져 있다(Dunez와 Sutic, 1988; James 등 2013; Maejima 등 2011). 또한 2016년 일본에서 병원성이 강하고 확산 속도가 빠른 M 계통이 발생함에 따라(Oishi 등, 2018) 자두곰보바이러스 감염 묘목 및 종자가 국내에 유입되지 않도록 해야하며, 지속적인 국내 자두곰보바이러스 발생, 계통 조사 및 자두곰보병 박멸을 위한 발생 원인 구명 등 추가적인 연구가 이루어져야 할 것으로 생각된다.

요 약

전 세계적으로 자두곰보바이러스는 핵과류에 발생하는 중요한 바이러스이다. 2015년 국내 복숭아에서 자두곰보바이러스 감염이 확인된 이후 국내 핵과류 과원에 대한 자두곰보바이러스 발생 조사가 시작되었다. 2016-2017년 국내 핵과류 1,985과원의 30,333주 나무에서 시료를 채집하여 특이 프라이머를 이용한 RT-PCR 검정 결과, 10과원의 21주 나무에서 자두곰보바이러스가 확인되었고, 박멸조치에 따라 감염 주에 대한 폐기 등 방제가 실시되었다. 2016년 자두곰보바이러스에 감염된 복숭아 나무 7주의 total RNA에서 PCR 산물 약 547 bp을 얻은 후 direct sequencing 하여 염기서열을 결정하였다. BLAST 검색 결과 Genbank에 등록된 자두곰보바이러스 D 계통 분리 주들 (LC331298, LT600782)과 99% 높은 염기서열 상동성을 보였으며, 국내 복숭아 나무 7개 분리 주 간에 98–100% 염기서열 상동성을 보였다. Phylogenetic tree 분석 결과 한국, 일본, 미국, 캐나다에서 보고된 D 계통과 높은 유연관계를 가지는 것을 확인 할 수 있었다. 이 보고는 2016–2017년 국내 핵과류 과원의 자두곰보바이러스 발생 현황에 대한 첫 보고이며, 이를 바탕으로 발생 주 제거 등 국내 금지급 자두곰보병의 예방 및 방제 대책 수립을 위한 기초자료로 활용하고자 하였다.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgement

This study was carried out with the support of Cooperative Research program for Agricultural Science & Technology Development (Project No. PJ01242805) Rural Development Administration, Republic of Korea.

References
  1. Adams, M. J, Zerbini, F. M, French, R, Rabenstein, F, Stenger, D. C, and Valkonen, J. P. T. 2011. Family Potyviridae. In: Virus taxonomy:Ninth report of the international committee on taxonomy of viruses . eds. by King. A. M. Q, Adams. M. J, Carstens. E. B, and Lefkowitz. E. J , pp. 1069-1089. Academic Press, San Diego, USA.
    CrossRef
  2. Atanasoff, D. 1932. Plum pox. A new virus disease. Yearbook University of Sofa. Fac. Agric. Silvicul 11: 49-69.
  3. Cambra, M, Capote, N, Myrta, A, and Llácer, G. 2006. Plum pox virus and the estimated costs associated with Sharka disease. EPPO Bulletin 36: 202-204.
    CrossRef
  4. Candresse, T, Dosba, F, Quiot, J. B, and Dunez, J, 1993 The sharka:The state of research Fruit tree Arboriculture 464, 30-35. URL http://www.arboriculture-fruitiere.com
  5. Cho, I. S, Cho, J. D, Choi, S. K, and Choi, G. S. 2012. Occurrence of stone fruit viruses of Peach trees (Prunus persica L. Batsch) in Korea. Res. Plant Dis 18: 391-395.
    CrossRef
  6. Dallot, S, Labonne, G, Boeglin, M, Quiot-Douine, L, Quiot, J. B, and Candresse, T. 1998. Peculiar plum pox potyvirus D-populations are epidemic in peach trees. Acta Hortic 472: 355-364.
    CrossRef
  7. Damsteegt, V. D, Scorza, R, Stone, A. L, Schneider, W. L, Webb, K, and Demuth, M et al. 2007. Prunus host range of Plum pox virus (PPV) in the United States by aphid and graft inoculation. Plant Dis 91: 18-23.
    Pubmed CrossRef
  8. Dunez, J, and Sutic, D. 1988. Plum pox virus. In: European Handbook of Plant Diseases . eds. by Smith. I. M, Dunez. J, Phillips. D. H, Lelliott. R. A, and Archer. S. A , pp. 44-46. Blackwell, Oxford, UK.
  9. Fauquet, C. M, Mayo, A. M, Maniloff, J, Desselberger, U, and Ball, L. A. 2005. Virus taxonomy:Eighth report of the international committee on taxonomy of viruses . Academic Press, Amsterdam, The Netherlands. 1162 pp.
  10. Fereres, A, and Moreno, A. 2009. Behavioural aspects influencing plant virus transmission by homopteran insects. Virus Res 141: 158-168.
    Pubmed CrossRef
  11. García, J. A, Glasa, M, Cambra, M, and Candresse, T. 2014. Plum pox virus and sharka:A model potyvirus and a major disease. Mol. Plant Pathol 15: 226-241.
    Pubmed CrossRef
  12. Glasa, M, Marie-Jeanne, V, Labonne, G, Šubr, A, Kúdela, O, and Quiot, J.-B. 2002. A natural population of recombinant Plum pox virus is viable and competitive under field conditions. Eur. J. Plant Pathol 108: 843-853.
    CrossRef
  13. Glasa, M, Prikhodko, Y, Predajňa, L, Nagyová, A, Shneyder, Y, and Zhivaeva, T et al. 2013. Characterization of sour cherry isolates of plum pox virus from the Volga Basin in Russia reveals a new cherry strain of the virus. Phytopathology 103: 972-979.
    Pubmed CrossRef
  14. Goytia, E, Fernández-Calvino, L, Martínez-García, B, López-Abella, D, and López-Moya, J. J. 2006. Production of plum pox virus HC-Pro functionally active for aphid transmission in a transient expression system. J. Gen. Virol 87: 3413-3423.
    Pubmed CrossRef
  15. Gottwald, T. R. 2006. Epidemiology of sharka disease in North America. EPPO Bulletin 36: 279-286.
    CrossRef
  16. James, D, Varga, A, and Sanderson, D. 2013. Genetic diversity of Plum pox virus:Strains, disease and related challenges for control. Can. J. Plant Pathol 35: 431-441.
    CrossRef
  17. Labonne, G, Lauriaut, F, Yvon, M, and Quiot, J. B. 1994. Aphid transmission of Plum pox potyvirus:Analysis of potential vectors in an apricot orchard. EPPO Bulletin 24: 681-690. (In French)
    CrossRef
  18. Levy, L, Damsteegt, V, and Welliver, R. 2000. First report of plum pox virus (Sharka disease) in Prunus persica in the United States. Plant Dis 84: 202.
    Pubmed CrossRef
  19. Lim, S, Igori, D, Yoo, R. H, Zhao, F, Cho, I. S, and Choi, G. S et al. 2015. Genomic detection and characterization of a Korean isolate of Little cherry virus 1 sampled from a peach tree. Virus Genes 51: 260-266.
    Pubmed CrossRef
  20. Llácer, G, and Cambra, M. 1998. Thirteen years of Sharka disease in Valencia, Spain. Acta Hortic 472: 379-384.
    CrossRef
  21. Lopez-Moya, J. J, Canto, T, Díaz-Ruíz, J. R, and López-Abella, D. 1995. Transmission by aphids of a naturally non-transmissible plum pox virus isolate with the aid of potato virus Y helper component. J. Gen. Virol 76: 2293-2297.
    Pubmed CrossRef
  22. Lopez-Moya, J. J, and García, J. A. 1999. Potyviruses (Potyviridae). In: Encyclopaedia of virology . eds. by Webster. R. G, and Granoff. A , pp. 369-1375. Academic Press, London, UK.
    CrossRef
  23. Maejima, K, Hoshi, H, Hashimoto, M, Himeno, M, Kawanishi, T, and Komatsu, K et al. 2010. First report of plum pox virus infecting Japanese apricot (Prunus mume Sieb. et Zucc.) in Japan. J. Gen. Plant Pathol 76: 229-231.
    CrossRef
  24. Maejima, K, Himeno, M, Komatsu, K, Takinami, Y, Hashimoto, M, and Takahashi, S et al. 2011. Molecular epidemiology of plum pox virus in Japan. Phytopathology 101: 567-574.
    Pubmed CrossRef
  25. Mumford, R. A. 2006. Control and monitoring:control of plum pox virus in the United Kingdom. EPPO Bulletin 36: 315-318.
    CrossRef
  26. Myrta, A, Di Terlitzzi, B, Savino, V, and Martelli, G. P. 2006. Control and monitoring:monitoring and eradication of sharka in southeast Italy over 15 years. EPPO Bulletin 36: 309-311.
    CrossRef
  27. Navratil, M, Safarova, D, Kresova, R, and Petrzik, K. 2005. First incidence of plum pox virus on apricot trees in China. Plant Dis 89: 338.
    Pubmed CrossRef
  28. Németh, M. 1994. History and importance of plum pox in stonefruit production. EPPO Bulletin 24: 525-536.
    CrossRef
  29. Oh, J. H, Park, C. Y, Lee, H.-K, Yeom, Y.-A, Lim, S. M, and Moon, J.-S et al. 2017. First report of plum pox virus strain D isolate in Peach (Prunus persica) in Korea. Plant Dis 101: 265.
    CrossRef
  30. Oishi, M, Inoue, Y, Kagatsume, R, Shukuya, T, Kasukabe, R, and Oya, H et al. 2018. First report of plum pox virus strain M in Japan. Plant Dis 102: 829.
    CrossRef
  31. Ramel, M. E, Gugerli, P, and Bünter, M. 2006. Control and monitoring:eradication of Plum pox virus in Switzerland. EPPO Bulletin 36: 312-314.
    CrossRef
  32. Redding, R. C. 2010. Revision of quarantine and program orders relating to plum pox virus. Pennsyl. Bulletin 40: 7242.
  33. Reyes, F, Fiore, N, Reyes, M. A, Sepulveda, P, Paredes, V, and Prieto, H. 2003. Biological behavior and partial molecular characterization of six Chilean isolates of plum pox virus. Plant Dis 87: 15-20.
    Pubmed CrossRef
  34. Rosales, M, Hinrichsen, P, and Herrera, G. 1998. Molecular characterization of plum pox virus isolated from apricots, plums, and peaches in Chile. Acta Hortic 472: 401-406.
    CrossRef
  35. Roy, S, and Smith, I. M. 1994. Plum pox situation in Europe. EPPO Bulletin 24: 515-523.
    CrossRef
  36. Shin, Y.-G, and Lee, K.-H. 2013. List of Plant quarantine viruses in Korea newly revised in 2013. Res. Plant Dis 19: 67-75.
  37. Speich, P. 2006. Control and monitoring:Plum pox virus quarantine situation in France. EPPO Bulletin 36: 307-308.
    CrossRef
  38. Tsuda, S, and Sano, T. 2014. Threats to Japanese agriculture from newly emerged plant viruses and viroids. J. Gen. Plant Pathol 80: 2-14.
    CrossRef


March 2019, 25 (1)