search for




 

Investigation of Viruliferous Insect Rate of Planthoppers Captured by Smart Sky Net Trap (SSNT) in Korea during 2015-2017
Res. Plant Dis. 2018;24:201-212
Published online September 30, 2018
© 2018 The Korean Society of Plant Pathology.

Ji-Eun Choi1,4, Hae-Ryun Kwak1, Mi-Kyeong Kim1, Tae-Woo Jeong2, Jang-Kyun Seo3, Jeong-Soo Kim4,*, and Hong-Soo Choi1,*

1Crop Protection Division, National Institute of Agricultural Sciences, Wanju 55365, Korea,
2Taean Agriculture Technology & Extension, Taean 32150, Korea,
3Graduate School of International Agricultural Technology, Seoul National University, Pyeongchang 25354, Korea,
4Department of Plant Medicine, Andong National University, Andong 36729, Korea
J.-S. Kim Tel: +82-54-820-6224 Fax: +82-54-820-6320 E-mail: plvirus@anu.ac.kr
H.-S. Choi Tel: +82-63-238-3300 Fax: +82-63-238-3838 E-mail: hschoi@korea.kr
Received June 25, 2018; Revised August 20, 2018; Accepted August 20, 2018.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Major viruses infecting rice are transmitted by planthoppers such as small brown planthopper (SBPH), brown planthopper (BPH) and white-backed planthopper (WBPH). In this study, we investigated planthoppers captured during 2015 to 2017 by a smart sky net trap (SSNT) system installed in 40 areas in Korea, which is an automatic, rapid and real-time insect surveillance system. The average rates of captured migration plnathoppers was 27.5%, 17.2%, 15.3% and 10.9% in Chungcheongnamdo, Jeollanamdo, Jeollabukdo and Gyeonggido, orderly. The highly migrated month was July for SBPH, July to August for WBPH and August for BPH. To investigate the viruliferous rates of planthoppers of rice during 2015 to 2017, we performed RT-PCR using specific primers for each rice virus. RBSDV was detected from 0.4% in SBPH, while no viruses were detected in BPH and SBPH. Rice planthoppers exist all around in Asia. They can move long distance by wind from southern countries to Korea. Monitoring the migration of rice planthoppers and their viruliferous rates is important to prevent the outbreaks of rice virus diseases.

Keywords : Planthopper, Rice-infecting viruses, Viruliferus insect
서론

세계적으로 벼에 감염하는 바이러스는 25종(Abo와 Sy, 1997)이며, 이 중 국내에서 발생하는 바이러스는 3종으로 벼줄무늬잎마름바이러스(Rice stripe virus, RSV), 벼검은줄위축바이러스(Rice black-streaked dwarf virus, RBSDV) 및 벼위축바이러스(Rice dwarf virus, RDV)가 보고되었다(한국식물병명목록, 2009). RSV와 RBSDV의 매개충은 애멸구(Laodelphax striatellus, Small brown planthopper, SBPH)이며, RDV의 매개충은 끝동 매미충(Nephotettix cincticeps)으로 알려져있다(Kim 등, 2008; Kuribayash 등, 1952; Nasu, 1963). 애멸구는 국내 토착해충으로 보고되었으나, 2009년에 기류를 통해서도 유입되는 것이 확인되었다(Kim 등, 2009a; Otuka 등, 2010). 국내로 유입되는 비래해충은 애멸구 외에 벼멸구(Nilaparvata lugens, Brown planthopper, BPH)와 흰등멸구(Sogatella furcifera, White backed planthopper, WBPH)가 알려져 있다(Otuka, 2010). 이동성 멸구류인 애멸구, 벼멸구와 흰등멸구는 국내를 비롯하여 아시아 전역과 호주 북부, 남태평양군도 등, 벼 재배지에 광범위하게 분포하고 있는 것으로 보고되었다(Abraham과 Nair, 1975; Chen과 Cheng, 1979; Fernando, 1975; Hinckley, 1963; Otuka, 2013).

애멸구에 의해 영속전염하는 RSV는 Phenuiviridae과, Tenuivirus속에 분류되며, 구조학적으로 사상형 바이러스에 속한다(The Online 10th Report of the International Committee on Taxonomy of Viruses, 2016). RSV는 1935년에 진주, 밀양 및 구례지역에서 최초로 발생하였으며, 1964년과 1965년에 경북과 전북에서 발생하여 약 40%의 수량 감소 피해를 발생시켰다(Chung과 Lee, 1971; Kim 등, 2009b). 2001년에는 경기도 화성과 인천광역시 강화 등 약 4,663 ha에서 대발생하였으며, 2005년에 남부지방에서 대발생하였고 같은 해에 중국에서도 발생하여 큰 피해가 보고되었다(Park 등, 2009; Song, 2007). 2007년에는 충남 서천 및 전북 부안 지역의 4,457 ha에서 발생하였으며, 2008년은 전남 진도 및 해남 등의 2,828 ha에 발생하였다(Kim 등, 2008; RDA, 2015). 2009년에는 경기도 김포, 인천광역시 강화, 충남 태안 및 전남 해남 등 서해안지역의 24,514 ha에서 대발생하였으며, 또한 동해안 지역인 강릉 등을 포함하여 전국적으로 발생하였다(Kim 등, 2009c). 2007년부터 3년간 RSV가 크게 발생한 원인으로 매개충인 애멸구 성충이 본답 이앙 초기인 5월 말-6월 초에 중국으로부터 대량 비래하여 서해안 일대에 RSV가 발생한 것으로 보고되었다(Kim 등, 2008; Otuka 등, 2010). 또한 2011년은 충남 서천과 보령, 전북 부안과 김제, 전남 해남과 진도 등에서 7,397 ha에 발생하였다(Kim 등, 2011; RDA, 2015).

RBSDV는 Reoviridae과, Fijivirus속에 분류되며, 구조학적으로 구형 바이러스에 속한다. 감염 식물체는 위축, 잎의 뒤틀림 및 생육저하 등의 병증이 나타난다. RBSDV는 일본에서 처음 보고(1941년)된 후 중국(1965년)과 국내경북 선산(1973년)에서도 보고되었다(Lee 등, 1977, 2005). RBSDV는 1970년대 인도계(indica)의 다수성 품종의 재배 면적 확대로 1975-1976년에 전국적으로 발생하였으며, 1984년에는 전국 벼 재배 면적의 70% 정도까지 발생하였다.

흰등멸구가 매개하는 Southern rice black-streaked dwarf virus (SRBSDV)는 Reoviridae과, Fijivirus속에 속하며 중국, 일본, 베트남에서 보고되었다(Matsukura 등, 2013; Zhou 등, 2008).

벼멸구가 매개하는 바이러스는 Rice grassy stunt virus (RGSV)와 Rice ragged stunt virus (RRSV)로 RGSV는 Phenuiviridae과, Tenuivirus속에 속하며, 베트남 남부와 대만, 중국 및 일본 등 동남아시아에서 보고되었다(Cabauatan 등, 2009). RRSV는 Reoviridae과, Oryzavirus속에 속하며, 베트남 남부와 말레이시아에서 보고되었다(Cabauatan 등, 2009). RRSV와 RGSV에 복합 감염되면 황화 및 위축의 황화병(Yellowing syndrome disease)을 일으킨다(Pham 등, 2007). 황화병은 전염이 빠르고 생산량에 크게 영향을 미치기 때문에 초기 방제가 중요하다. 2006년과 2007년에 베트남 남부의 안장, 깐토 및 띠엔장에서 황화병이 발생하여 51,507 ha의 피해가 보고되었다(RDA, 2015).

애멸구를 제외한 흰등멸구와 벼멸구는 국내에서 겨울철을 지나지 못하기 때문에 세대가 단절되고 매년 새로운 비래 개체군이 형성된다. 따라서 여름철에 조성된 개체군에는 천적 증식 및 저항성 품종 등의 효과가 지속되지 않으므로 비래 개체군의 조절과 질적 변화의 예측이 불가능하였다. 또한 이동성 멸구류가 논에서 대량으로 발견되어 어떠한 방제 행위를 취할 때는 이미 벼에 피해를 줄만큼 밀도가 증가하였기 때문에 방제비용만 소모하고 큰 효과를 거두지 못하는 경우가 많았다(Park 등, 1976). 따라서 이동성 멸구류의 피해 예방은 신속한 비래 시기를 예측하는 것이 가장 중요하다.

Kwon 등 (2018)은 2011-2015년 동안 Aerial collection net (AeCN)과 Light trap (LT)를 이용하여 애멸구의 밀도를 조사하였다(Kwon 등, 2018). AeCN을 이용하여 2011년부터 2015년 동안 포획한 개체수는 각 2,303마리, 824마리, 523마리, 2,863마리, 952마리로 총 7,465마리였으며, LT를 이용한 개체수는 각 2,463마리, 1,136마리, 1,389마리, 990마리, 2,405마리로 총 8,383마리였다. 5년 동안 지역에 따라 큰 개체수의 차이를 보였으며, 대부분의 애멸구는 남서부 지역에서 포획되었다.

최근 비래 멸구류의 실시간 예찰 장비인 스마트 공중 포집기(Smart Sky Net Trap, SSNT)가 국내에서 개발되어 전국에 설치되어 운영 중이다. 그러나, 연도별 지역별 비래 상황에 대한 분석이 미비하며 비래 멸구류의 보독충률 조사는 RSV와 RBSDV를 매개하는 애멸구에 대해 2008-2010년 동안 조사가 이뤄졌지만 최근에는 조사가 없었으며, 흰등멸구와 벼멸구의 보독충률에 대한 조사는 전혀 이루어지지 않고 있다. 따라서 본 연구에서는 2015-2017년 스마트 공중 포집기에 포획된 멸구류의 비래 밀도 분석과 RSV를 포함한 5종 바이러스에 대한 멸구류의 보독충률을 조사하였다. 이 분석 자료를 통해 벼 바이러스 발생을 예측하여 국내 벼 재배지역에서 벼 바이러스의 발생을 미연에 방지하는데 활용하고자 한다.

재료 및 방법

멸구류 시료 수집

2015-2017년 동안 스마트 공중 포집기(smart sky net trap, SSNT)에 포획된 멸구류의 밀도 변화를 분석하였다. SSNT는 국립농업과학원(National institute of Agricultural Sciences)에서 2014년에 ㈜이티엔디와 ㈜섬진이앤아이티와 공동 개발하였으며(Fig. 1A), 2015년부터 설치를 시작하여 2017년에는 전국 40개 지역에 설치되었다(Fig. 1B). SSNT는 스마트폰이나 PC 활용으로 실시간 해충 포집 수 및 해충의 원격 육안식별을 통한 멸구류의 정확한 비래를 확인 할 수 있는 장비로, 강제흡입식 포집으로 풍속에 관계없이 포집량이 균일하고, 실시간 예찰이 가능하여, 방제적기를 실시간으로 판단할 수있다. 멸구류 분석을 위해 SSNT가 설치된 지역의 농업기술센터에서 애멸구(SBPH), 흰등멸구(WBPH) 및 벼멸구(BPH)를 실시간으로 분류하여 시스템에 등록한 자료를 이용하였다.

Fig. 1.

Smart Sky Net Trap (SSNT). (A) Structure of SSNT, (B) Real-time rice planthopper monitoring system, (C) SSNT installation sites (40 areas).


SSNT에 포획된 멸구류의 개체수 분석을 수행한 지역은 총 40개 지역으로 다음과 같다. 강원도 2지역(원주, 철원), 경기도 6지역(김포, 안성, 양주, 연천, 이천, 화성), 경상남도 2지역(밀양, 사천), 경상북도 2지역(상주, 성주), 전라남도 11지역(강진, 광주, 나주, 무안, 신안, 영광, 영암, 완도, 장흥, 진도, 해남), 전라북도 6지역(고창, 군산, 김제, 부안, 순창, 정읍), 충청남도 10지역(논산, 당진, 천안, 보령, 서산, 서천, 아산, 예산, 태안, 홍성) 및 충청북도 1지역(영동)이었다(Fig. 1C). 특히, 동해안지역은 태백산맥이 남서기류를 차단하여 비래 개체수가 적기 때문에 비교적 적은 SSNT가 설치되었다(Kim과 Lee, 2007).

멸구류가 대량 비래하는 시기의 기상을 확인하기 위해서 www.apcc21.org에서 제공하는 Climate Information Service를 이용하여 기상 정보를 확보하였다.

보독충률 조사는 SSNT 설치지역의 농업기술센터에서 수집한 각 멸구류의 시료를 이용하였다. 2015년 서천 96마리, 하동 100마리, 부안 87마리, 신안 100마리, 해남 100마리 및 영광 97마리로 총 580마리, 2016년 완도 774마리, 태안 133마리 및 영광 36마리로 총 943마리, 2017년 태안 115마리, 서천 95마리, 보령 95마리, 군산 93마리, 완도 95마리 및 김포 100마리로 총 593마리를 제공 받아 전체 2,116마리의 멸구류를 사용하였다. 제공받은 사충 시료는 -80°C에서 보관하였다.

Total RNA 추출

SSNT가 설치된 지역에서 수집한 애멸구, 흰등멸구 및 벼멸구로부터 Easy-spin™ total RNA extraction kit (iNtRon Biotechnology, Inc., Gyenggi-do, Korea)를 사용하여 제조사의 매뉴얼에 따라 Total RNA를 추출하였다. 멸구류를 1-10마리씩 1.5 ml Tube에 옮겨 담고, Lysis buffer 50 μl를 첨가하고 마쇄 봉으로 갈아준 후 Lysis buffer를 950 μl를 추가하였다. 강하게 교반한 후, 13,000 rpm으로 10분간 원심분리하였다. 1.5 ml 튜브에 상층액 400 μl와 Binding buffer 400 μl를 약하게 섞어주었다. 컬럼에 혼합액을 넣고 13,000 rpm으로 1분간 원심 분리한 후, 걸러진 용액은 버리고 핵산이 흡착된 컬럼에 Washing buffer A를 700 μl를 첨가하고 13,000 rpm으로 1분간 원심분리 한 후, 걸러진 용액은 버린다. 다시 Washing buffer B를 핵산이 흡착된 컬럼에 700 μl를 첨가하여 희석시킨 후 13,000 rpm으로 1분간 원심분리하여 컬럼의 불순물을 제거하였다. 컬럼을 13,000 rpm으로 3분간 원심분리하여 컬럼에 남아있는 에탄올을 제거하고, 1.5 ml 튜브에 컬럼을 끼우고 상온에서 2분간 건조시킨다. Elution buffer 50 μl를 컬럼에 넣어 1분간 상온에서 흡수시킨 후, 13,000 rpm으로 2분간 원심분리하여 핵산을 추출한다. -20°C 냉동고에 보관하였으며 유전자 진단에 사용하였다.

Reverse transcription-polymerase chain reaction (RTPCR)

RT-PCR 반응액 조제는 GeNet Bio 사의 SuPrimerScript RT-PCR Premix (2X)를 이용하였으며, Premix 10 μl, Total RNA 1 μl, downstream primer와 upstream primer 각각 1 μl, D.W. 7 μl를 첨가하여 총 20 μl의 혼합물을 만들었다. RT-PCR 조건은 42°C에서 30분, 95°C 5분간하였고 95°C 30초, 55°C 30초, 72°C 1분에서 35회 반복하고 마지막으로 72°C에서 5분간 반응시켰다. 전기영동은 ethidium bromide가 포함된 1.0% Agarose gel에 PCR 증폭산물 4 μl를 로딩하고, 100 V에서 60분 동안 전개하였다. Molecular Imager Gel Doc XR system (Bio-Rad, Laboratories, Hercules, CA)을 사용하여 유전자 진단 특이 프라이머를 사용한 증폭 산물의 사진을 촬영하였다.

벼 바이러스 유전자 특이 프라이머 및 증폭 산물 크기

이동성 멸구류인 애멸구, 흰등멸구와 벼멸구 3종이 매개하는 RSV, RBSDV, SRBSDV, RGSV 및 RRSV 5종 바이러스에 대하여 사용한 유전자 진단용 특이 프라이머는 국립농업과학원 식물바이러스연구실에서 개발한 것을 사용하였다(Table 1). SRBSDV의 경우 양성 대조(positive control) 바이러스의 특이 프라이머들은 중국에서 개발한 S10-F와 S10-R, 국립식량과학원에서 개발한 S10-600F와 S10-600을 동시에 사용하였다(Table 1).

Specific detection primer sets for rice-infecting viruses transmitted by the migrated planthoppers in Korea

VectoraVirusbPrimerc nameSequence (5’→3’)Size (bp)
SBPHRSV RS4-N30CATCACAGTGTCACTGGTCTTCAT571
 RS4-C10AGTTGATAATAAGAATAGGAAATC

RBSDV RB-N30TGATCCCGATGAATAGAATTGACC380
 RB-C40AATCAAAACAAGGTACAGCCAAAGA

BPHRGSV RG-FGAAGGTTYTTAGAGTACATACCTCA435
 RG-RGCAATCTTGTGTCTTGGTTGACCC

RRSV RR-FGAAGCTAAGCCTCAGACTCTTC595
 RR-RACGATCTTCTTACCTTGCACAAAC

WBPHSRBSDV S10-F1ACCCCACATCGCGTCATCTC724
 S10-R1AGGAGACTCCGCTCCATGTTTG

 S10-F2ACGTTCCGGAAAATTAAGAATTG657
 S10-R2TGCAGGGAGCAGCTAATGCC

 S10-FCTCCGCTGACGGTTTAGAAG242
 S10-RGGTCGTAACCGCCATAGTGT

 S10-600FACAATGATAAGAAATTCATCGAA650
 S10-600RAATCTTTTGACCATGTTCTGAA

aSBPH: Small brown planthopper, BPH: Brown planthopper, WBPH: White-backed planthopper.

bRSV: Rice stripe virus, RBSDV: Rice black-streaked dwarf virus, RGSV: Rice grassy stunt virus, RRSV: Rice ragged stunt virus, SRBSDV: Southern rice black-streaked dwarf virus.

cS10-F/S10-R primers from Guizhou university in China (Zhuo Chen, 2013); S10-600F/S10-600R primers from National institute of crop science in Korea.


결과 및 고찰

2015-2017년 SSNT에 포획된 이동성 멸구류의 연도별 포집 개체수 분석

2015-2017년 동안 SSNT에 포획된 애멸구를 포함한 3종 멸구류에 대하여 연도별, 지역별로 평균 포집 개체수(포집 개체수/포집기수)를 분석하였다(Table 2).

Average number of planthoppersa captured by SSNT during 2015-2017

 ProvincebSBPHWBPHBPHTotal (%)



2015d2016e2017f201520162017201520162017
Chungbuk55142020100029.0 (1.6)
Chungnam32.224.8331.316.538.58.623.517.34.40497.1 (27.5)
Gangwon-c290-25.516-12.520085.0 (4.7)
Gyeongbuk141320.830.530.811.53.50124.1 (6.9)
Gyeonggi22.320.797.519.317.75.65.77.31.50197.6 (10.9)
Gyeongnam5431.553.534975.564.520288.0 (15.9)
Jeonbuk87.322.769.331.7323.8216.81.80276.4 (15.3)
Jeonnam9943.62.731.6937.110.8185.40311.2 (17.2)

Total300.8218.3600.3135.9334.251.667.878.920.61,808.4 (100)

aAverage number of planthoppers (No. of captured planthopper/No. of SSNT in each province).

The head of plant hoppers was calculated manually though stereomicroscopy in each Agricultural extension service.

bSSNT installation areas.

cNo installation of SSNT.

dCollected period: May 6-September 30.

eMay 1-September 30.

fJune 1-September 30.


애멸구의 평균 포집 개체수는 2015년에는 전라남도 99마리로 가장 많이 포획되었으며, 전라북도 87.3마리, 경상남도 54.0마리, 충청남도 32.2마리, 경기도 22.3마리, 충청북도 5.0마리 및 경상북도 1.0마리 순서였다. 반면, 내륙지역 중 2015년 SSNT가 설치되어있지 않은 강원도를 제외한 경상북도에서는 매우 낮은 포집 개체수를 보였다. 2016년 애멸구의 평균 포집 개체수는 2015년보다 0.7배 감소되었으며, 전라남도 43.6마리로 가장 많이 포획되었으며, 경상북도 41.0마리, 경상남도 31.5마리, 강원도 29.0마리, 충청남도 24.8마리, 전라북도 22.7마리, 경기도 20.7 마리 및 충청북도 5.0마리로 평균 포집 개체수가 가장 낮았다. 경상북도는 2015년에 비해 2016년 비래 개체수가 41배 증가하였고, 전라북도는 3.8배 감소하였다. 반면, 내륙지역인 충청북도에서 매우 낮은 포집 개체수를 보였다. 2017년 애멸구의 평균 포집 개체수는 2016년보다 2.7배 증가하였으며, 서해안지역인 충청남도 331.3마리로 가장 많이 포획되었으며, 경기도 97.5마리, 전라북도 69.3마리, 경상남도 53.5마리, 경상북도 32.0마리, 충청북도 14.0마리, 전라남도 2.7마리 순서였고 강원도에서는 포획되지 않았다. 경기도는 2016년에 비해 4.7배 증가하였으며, 전라남도는 2016년에 비해 16.1배 감소하였다. 또한 충청남도에서는 2016년에 비해 13.4배 증가하였다. 2015년부터 3년간 애멸구는 전라남도와 충청남도 등의 서해안지역을 중심으로 비래가 많았으며, 연도별로 각 지역에 비래하는 애멸구의 포집 개체수에는 차이가 있었다.

흰등멸구의 평균 포집 개체수는 2015년 경상남도 34.0마리로 가장 많이 포획되었으며, 전라북도 31.7마리, 전라남도 31.6마리, 경기도 19.3마리, 충청남도 16.5마리, 충청북도 2.0마리 및 경상북도 0.8마리로 포집 개체수가 가장 낮았다. 2016년에는 경상남도 97.0마리로 가장 많이 포획되었으며, 전라남도 93.0마리, 충청남도 38.5마리, 전라북도 32.0마리, 경상북도 30.5마리, 강원도 25.5마리, 경기도 17.7마리 및 충청북도 0.0마리로 포집 개체수가 가장 낮았다. 경상남도는 2015년보다 2.8배 증가하였으며 전라남도는 2.9배 증가하였다. 2017년에는 강원도에서 16.0마리로 가장 많이 포획되었으며, 충청남도 8.6마리, 전라남도 7.1마리, 경기도 5.6마리, 경상남도 5.5마리, 전라북도 3.8마리, 경상북도 3.0마리 및 충청북도 2.0마리로 포집 개체수가 가장 낮았다. 2016년 가장 많이 포획되었던 경상남도는 17.6배 감소하였으며, 전라남도는 13.3배 감소하였고 경상북도는 2016년보다 10.2배 증가하였다.

벼멸구의 평균 포집 개체수는 2015년 충청남도 23.5마리로 가장 많이 포획되었으며, 전라북도 21.0마리, 전라남도 10.8마리, 경상남도 6.0마리, 경기도 5.7마리, 경상북도 0.8마리 순서였고 충청북도에서는 포획되지 않았다. 2016년에는 전라남도 18.0마리로 가장 많이 포획되었으며, 충청남도 17.3마리, 강원도 12.5마리, 경상북도 11.5마리, 경기도 7.3마리, 전라북도 6.8마리, 경상남도 4.5마리 및 충청북도 1.0마리로 포집 개체수가 가장 낮았다. 경상북도는 2015년보다 14.3배 증가하였고, 전라북도는 3배 감소하였다. 2017년에는 전라남도 5.4마리로 가장 많이 포획되었으며, 충청남도 4.4마리, 경상북도 3.5마리, 강원도 2.0마리, 경상남도 2.0마리, 전라북도 1.8마리, 경기도 1.5마리 및 충청북도에서는 포획되지 않았다. 전라남도와 충청남도는 각각 3.3배, 3.9배 감소하였다. 흰등멸구와 벼멸구는 대체로 벼 생육 왕성기인 7-8월에 비래하기 때문에 피해 발생이 낮을 것으로 판단된다(Table 2).

2015년부터 3년간 비래된 평균 포집 개체수는 애멸구가 1,119.4마리로 가장 높았으며, 흰등멸구 521.7마리 및 벼멸구 167.3마리 순서였다(Table 2, Fig. 2A). 애멸구는 2015년 300.8마리, 2016년 218.3마리, 2017년 600.3마리로 2017년에 비래가 가장 많았으며, 2016년은 비래가 가장 적었다. 흰등멸구는 2015년 135.9마리, 2016년 334.2마리, 2017년 143.5마리로 2016년에 비래가 가장 많았고, 2015년은 비래가 가장 적었다. 벼멸구는 2015년 67.8마리, 2016년 78.9마리, 2017년 116마리로 2017년에 비래가 가장 많았으며, 2015년은 비래가 가장 적었다.

중국과 가까운 충청남도, 전라남도, 전라북도와 경기도의 서해안 지역에서 비래 포집 개체수 비율은 각각 27.5%, 17.2%, 15.3% 및 10.9%로 충청남도가 가장 높았다. 경상남도의 남해안 지역에서 비래 포집 개체수 비율은 15.9%였고, 경상북도와 강원도 지역의 동남부 지역은 6.9%와 4.7%로 상대적으로 낮았으며, 충청북도 내륙지역은 1.6%로 가장 낮았다(Table 2).

Fig. 2.

Yearly migrated planthoppers (A) captured by SSNT during 2015-2017; SBPH (B), WBPH (C), and BPH (D) captured by SSNT from May to September in 2015-2017.


2015-2017년 SSNT에 포획된 이동성 멸구류의 월별 평균 포집 개체수 분석

2015-2017년 동안 SSNT에 포획된 애멸구를 포함한 3종 멸구류의 평균 포집 개체수를 멸구류가 집중적으로 비래하는 시기인 5월부터 9월까지 월별로 분석하였다(Fig. 2).

애멸구(Fig. 2B)는 2015년 5월부터 9월까지 0.3마리, 2.3마리, 27.6마리, 15.6마리 및 6.3마리로 총 52.1마리가 비래하였고, 2016년은 0.9마리, 2.3마리, 3.7마리, 9.9마리 및 6.2마리로 총 23마리가 비래하였다. 2017년은 40.1마리, 48.9마리, 80.4마리, 14.4마리 및 0.1마리로 총 183.9마리가 비래하였고, 3년간 5월부터 9월까지 애멸구의 비래량은 2017년이 가장 높았다. 2015년부터 3년간 애멸구는 총 258.7마리가 포획되었으며 7월 비래는 43.2%로 비래가 가장 많았다. 2017년 애멸구가 대량 비래한 이유는 중국 병해충 발생정보에 따르면 겨울 기온이 평년보다 높아 밀도가 증가한 것으로 판단된다(2017 농작물 병해충 발생정보 제5호, http://ncpms.rda.go.kr).

흰등멸구(Fig. 2C)는 2015년 5월부터 9월까지 0.2마리, 0.1마리, 8.5마리, 10.9마리 및 2.5마리로 총 22.2마리가 비래하였고, 2016년은 0.0마리, 0.8마리, 18.9마리, 15.4마리 및 2.8마리로 총 37.9마리가 비래하였다. 2017년은 0.1마리, 0.0마리, 2.1마리, 4.6마리 및 0.0마리로 총 6.8마리가 비래하였고, 3년간 5월부터 9월까지 애멸구의 비래량은 2016년이 가장 높았다. 2015년부터 3년간 흰등멸구는 총 66.7마리가 포획되었으며 7월과 8월의 비래는 90.6%로 비래율이 가장 많았다. 2016년 7월 고온으로 8월에 서남해안의 방제가 소홀했던 논에서 흰등멸구의 흡즙 피해에 의한 고사 증상이 발생하였다. 2017년 비래된 개체수가 2016년보다 5.6배 낮은 이유는 비래 근원지인 중국 내 흰등멸구 밀도가 낮았기 때문으로 사료된다(2017 농작물 병해충 발생정보 제12호, http://ncpms.rda.go.kr).

벼멸구(Fig. 2D)는 2015년 5월부터 9월까지 0.1마리, 0.0마리, 3.9마리, 9.4마리 및 0.5마리로 총 13.9마리가 비래하였고, 2016년은 0.0마리, 0.6마리, 2.7마리, 5.0마리 및 2.4마리로 총 10.7마리가 비래하였다. 2017년은 0.4마리, 0.3마리, 1.4마리, 1.4마리 및 0.0마리로 총 3.5마리가 비래하였고, 3년간 5월부터 9월까지 애멸구의 비래량은 2015년이 가장 높았다. 2015년부터 3년간 벼멸구는 총 27.8마리가 포획되었으며 7월과 8월의 비래는 85.3%로 비래율이 가장 많았다. 흰등멸구와 벼멸구가 2016년 비래 개체수가 다른 연도보다 높은 이유는 중국 농업부 발표자료에 의하면 2016년 6월에서 7월 사이 저기압대가 많이 형성되어 확산과 이동에 유리하였기 때문에 2016년 멸구류의 개체수가 증가한 것으로 판단되었다.

2016-2017년 SSNT에 포획된 이동성 멸구류의 일별 포집 개체수 분석

2016년 6월-8월까지 애멸구를 포함한 3종 멸구류의 평균 포집 개체수를 일별로 분석하였다(Fig. 3A). 애멸구는 6월에 낮은 비래 밀도를 보이다가 7월은 15일 31마리, 21일 16마리 및 22일 13마리로 가장 많이 비래하였다. 3회 대량 비래 이후 낮은 비래 밀도를 보였으나 8월 26일 42마리로 가장 높은 비래 밀도를 보였다. 흰등멸구는 6월 낮은 비래 밀도를 보였으며 7월은 16일 97마리, 22일 126마리 및 27일 86마리로 가장 많이 비래하였다. 3회 대량 비래 이후 낮은 비래 밀도를 보였으나 8월 22일 58마리, 26일 62마리 및 30일 52마리가 비래하였다. 벼멸구는 6월은 대체로 비래 밀도가 낮았으나 7월 23일 15마리 및 27일 19마리가 비래하였으며 이후 낮은 비래 밀도를 보였으나 8월 30일 23마리로 가장 높은 비래 밀도를 보였다. 7월에 3종 멸구류가 동시에 대량 비래한 횟수는 3회였으며, 이 시기에 기후도를 확인한 결과, 중국과 필리핀 부근에서 형성된 고기압 사이로 우리나라를 향해 이동하는 저기압골이 형성된 이유에 기인한 것으로 생각한다(Fig. 3B). Otuka (2013)는 2008년에 발생한 애멸구의 비래에 대해서 느리게 움직이는 저기압이 한국을 통과하여 일본 서부까지 비래하였다고 추정하였다(Otuka, 2013).

Fig. 3.

Daily average number of planthoppers (A) and aerial currents of the highly captured date of planthoppers (B) by SSNT in 2016. Images were captured from http://www.apcc21.org/. The arrow indicated the direction of the aerial currents from China to Korea.


2017년 5월-7월까지 애멸구를 포함한 3종 멸구류의 비래 밀도를 일별로 분석하였다(Fig. 4A). 애멸구는 5월 중순까지 낮은 비래 밀도를 보였으나, 28일 868마리, 6월 7일 858마리 및 7월 10일 973마리로 3회 대량 비래하였다. 흰등멸구는 7월 6일까지 거의 발생하지 않았으나 7월 10일 38마리로 대량 비래하였다. 벼멸구는 5월부터 뜨문뜨문 발생하였으나 흰등멸구가 대량 비래한 7월 10일 6마리가 비래하였다. 2017년 5월에서 7월까지 멸구류의 대량 비래는 3회였으며 이 시기에 기후도를 확인한 결과, 2016년과 마찬가지로 저기압골이 형성되었다(Fig. 4B).

Fig. 4.

Daily average number of planthoppers (A) and aerial currents of the highly captured date of planthoppers (B) by SSNT in 2017. Images were captured from http://www.apcc21.org/. The arrow indicated the direction of the aerial currents from China to Korea.


우리나라로 비래하는 멸구류의 밀도는 기류 상황에 영향을 받는 것으로 판단된다. 또한, 애멸구는 벼 이앙 후 생육초기인 5월 말-6월 초에 비래하는 성충 애멸구가 피해 발생에 큰 영향을 주는 것으로 판단되며, 흰등멸구와 벼멸구가 비래하는 7월과 8월은 벼 생육 왕성시기이기 때문에 우리나라에서 크게 문제가 되지 않을 것으로 판단된다.

2015-2017년 SSNT에 포획된 이동성 멸구류의 바이러스 보독충률 조사

2015-2017년까지 SSNT에 포획된 애멸구를 포함한 3종 멸구류의 일부를 설치지역 농업기술센터에서 제공받아 보독충률을 조사하였다.

애멸구는 보령 95마리, 부안 87마리, 김포 100마리, 군산 93마리, 하동 100마리, 해남 100마리, 서천 191마리, 신안 100마리, 태안 117마리, 완도 103마리 및 영광 99마리로 11 지역에서 총 1,185마리를 포집하였고, RSV 보독충률을 검정한 결과, RSV를 보독한 애멸구는 진단되지 않았다(Table 3). RSV 피해율은 2015년 0.005%, 2016년 0.024% 및 2017년 0.001%로 매우 낮았다(National Crop Pest Management System, 2015). 2008-2010년 RSV 보독충률은 4.3%, 6.1% 및 7.2%로 2015-2017년 보독충률은 매우 낮았다. 그 이유로 중국 현지에서 애멸구의 RSV 보독충률은 0%로 RSV의 발생 피해가 낮았기 때문이라고 판단된다(2017 농작물 병해충 발생정보 제7호, http://ncpms.rda.go.kr). 또한, RBSDV를 보독한 애멸구는 부안 0.2%, 영광 0.1% 및 보령 0.1%로 총 0.4%로 진단되었다. 2009년의 RBSDV 보독충률은 4.1% (1.1-16.6%)로 매우 낮은 보독충률을 보였다(Kim 등, 2011). 따라서 비래 애멸구의 밀도뿐만 아니라 애멸구의 바이러스 보독충률이 국내 벼 바이러스 병 발생에 직접적인 관련이 있는 것으로 판단된다. 또한 벼 이앙 후 생육 초기인 5월말-6월초는 벼가 바이러스에 감염되기 쉬운 시기이기 때문에 이 시기에 비래하는 성충 애멸구는 피해 발생이 클 것으로 보인다.

Viruliferous SBPH of RSV and RBSDV in 2015-2017

 Area Collected dateaNo. of collected SBPHbInfectionc rate (%)c

RSVRBSDV
Buan15-3-188702 (0.2)
Hadong15-3-1810000
Haenam15-3-2410000
Seocheon15-3-189600
Shinan15-3-2410000
Yeonggwang15-3-249701 (0.1)

Taean16-8-3100
Taean16-9-73100
Wando16-8-2700
Wando16-8-3100
Yeonggwang16-8-3200

Boryung17-5-319501 (0.1)
Gimpo17-10-2110000
Gunsan17-5-311200
Gunsan17-6-28100
Seocheon17-5-319500
Taean17-5-318500
Wando17-6-89500

Total1,1850 (0.0%)4 (0.4)

aYear-month-day.

bSBPH was collected from each Agricultural extension service center.

cViruliferous SBPH was detected by RT-PCR. SBPH: Small brown planthopper, RSV: Rice stripe virus, RBSDV: Rice black-streaked dwarf virus.


비래 흰등멸구는 태안 118마리, 완도 754마리 및 영광 26마리로 3 지역에서 총 898마리를 포집하였고, SRBSDV 보독충률을 검정한 결과, SRBSDV를 보독한 흰등멸구는 없었다(Table 4). 중국에서 2011년 SRBSDV 대발생 이후 점차 보독충률이 줄어들고 있기 때문에 우리나라에서 SRBSDV를 보독한 흰등멸구가 없는 것으로 판단된다(Wu 등, 2017). 흰등멸구는 벼 생육 왕성 시기인 7월-8월에 비래하기 때문에 SRBSDV는 우리나라에서 큰 문제가 되지 않을 것으로 판단된다.

Viruliferous WBPH of SRBSDV in 2016-2017

 Area Collected dateaNo. of collected WBPHbInfection rate (%)c

SRBSDV
Taean16-8-3170
Taean16-9-7710
Taean17-10-16300
Wando16-8-27200
Wando16-8-3340
Yeonggwang16-8-3260

Total8980 (0.0%)

aYear-month-date.

bWBPH was collected from each Agricultural extension service center.

cViruliferous WBPH was detected by RT-PCR. WBPH: White-backed plathopper, SRBSDV: Southern rice black-streaked dwarf virus.


비래 벼멸구는 태안 13마리, 완도 12마리 및 영광 8마리로 3지역에서 총 33마리를 포집하였고, RGSV와 RRSV 보독충률을 검정한 결과, 두 바이러스를 보독한 벼멸구는 없었다(Table 5). 우리나라에서 1998년 벼멸구의 해충 피해 이후 발생량이 점차 줄어들고 있기 때문이라고 판단된다(Song, 1999). 벼멸구는 흰등멸구와 마찬가지로 벼 생육 왕성시기인 7월-8월 비래하기 때문에 RRSV와 RGSV는 우리나라에서 큰 문제가 되지 않을 것으로 판단된다.

Viruliferous BPH of RGSV and RRSV in 2016

 Area Collected dateaNo. of collected BPHbInfection rate (%)c

RGSVRRSV
Taean16-8-3200
Taean16-9-71100
Wando16-8-2900
Wando16-8-3300
Yeonggwang16-8-3800

Total330 (0.0%)0 (0.0%)

aYear-month-date.

bBPH was collected from each Agricultural extension service center.

cViruliferous BPH was detected by RT-PCR. RGSV: Rice grassy stunt virus, RRSV: Rice ragged stunt virus.


우리나라 벼 바이러스 병의 대발생은 비래 매개충 집단의 밀도, 보독충률, 대기의 영향을 받으며, 2015-2017년 중국 비래 성충 애멸구의 RSV 보독충률이 없었던 이유는 중국에서 RSV 보독충률이 매우 낮았기 때문이다. 따라서 중국의 RSV 발생 상황에 따라 우리나라에서 RSV에 의한 피해 정도도 달라질 것으로 보인다. 벼 이앙 후 생육 초기인 5월 말-6월 초에 비래하는 성충 애멸구가 벼 바이러스 피해 발생에 직접적인 영향을 주는 것으로 보이며, 과거 RSV가 대발생했던 2009년과 2011년 5월말-6월 초에 애멸구가 대량 비래하였다. 또한 2017년 애멸구가 대량 비래하였지만, 벼 바이러스 피해율이 낮은 이유는 애멸구의 RSV 보독충률이 매우 낮았기 때문이며, 따라서 해충 긴급방제는 보독충률 검사와 병행되어야 할 것으로 판단된다.

요약

본 연구에서는 2015년-2017년 사이에 실시간 예찰 장비인 스마트 공중 포집기(SSNT)에 의해 포획된 멸구류 3종, 애멸구, 흰등멸구, 벼멸구의 비래 밀도를 분석하였으며, 각 멸구류가 전염하는 바이러스에 대하여 보독충률을 조사하였다. 중국과 가까운 충남, 전남, 전북과 경기도의 서해안 지역의 경우, 비래 밀도는 각각 27.5%, 17.2%, 15.3% 및 10.9%로 충남의 비래 밀도가 가장 높았고, 남해안 지역인 경남 지역의 비래 밀도는 15.9%였다. 그러나 경북과 강원도 지역의 동남부 지역에서 비래 밀도는 6.9%, 4.7%로 상대적으로 낮았으며, 충북의 내륙지역에서 비래 밀도는 1.6%로 가장 낮았다. 2015년부터 3년간 멸구류의 월별 대량 비래 시기는 애멸구는 7월, 흰등멸구와 벼멸구는 7-8월이었다. 2016년 이동성 멸구류 3종의 일별 대량 비래는 7월 중·하순에 7월 15일, 21일, 27일로 3회였으며, 2017년은 5월 28일, 6월 7일 및 7월 8일로 3회였다. 이 시기의 기후도는 중국과 필리핀 부근에서 형성된 고기압 사이로 우리나라를 향해 이동하는 저기압 골이 형성되었다. 2015-2017년 SSNT에 포획된 비래 멸구류의 바이러스 보독충률 조사는 RSV 등 5종의 벼 바이러스에 대하여 RT-PCR 유전자 진단을 하였다. 애멸구 1,185마리를 대상으로 RSV와 RBSCV를 검정한 결과 RSV는 검출되지 않았고, RBSDV는 0.4%의 보독충률을 보였다. 흰등멸구 898마리를 검정한 결과 SRBSDV를 보독 한 개체는 없었으며, 벼멸구 33마리를 대상으로 검정한 결과 RRSV와 RGSV를 보독한 개체는 없었다.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This research was supported by the Agenda Program(PJ01194801) funded by the Rural Development Administration of Korea.

References
  1. Abo M.E, and Sy A.A. (1997) Rice virus diseases:epidemiology and management strategies. J.Sustain. Agric 11, 113-134.
    CrossRef
  2. Abraham C.C, and Nair M.R. G.K. (1975) The brown planthopper outbreaks in Kerala, India. Rice Entomol News 2, 36.
  3. Cabauatan P.Q, Cabunagan R.C, and Choi I.R. (2009) Rice viruses transmitted by the brown planthopper Nilaparvata lugens Stål. Planthoppers:New Threats to the Sustainability of Intensive Rice Production Systems in Asia , 357-368.
  4. Chen C.N, and Cheng C.C. (1979) Ecological physiology of rice plants attacked by the brown planthopper. Proceedings of the ROC Japan Symposium on Rice productivity, Monograph series no. 3, Hsieh K.C (ed.) , pp.135-146. Academia Sinica, Nankang, Taiwan.
  5. Chung B.J, and Lee S.H. (1971) Studies on the damage of Rice stripe virus disease. Res. Rept. RDA 14, 91-98.
  6. Fernando H.E. (1975) The brown planthopper problem in Sri Lanka. Rice Entomol. News 2, 34-36.
  7. Hinckley A.D. (1963) Ecology and control of rice planthoppers in Fiji. Bull. Entomol. Res 54, 467-481.
    CrossRef
  8. Kim J.S, Lee S.H, Choi H.S, Choi G.S, Cho J.D, and Chung B.N. (2008) Survey of viral diseases occurrence on major crops in 2007. Res. Plant Dis 14, 1-9.
    CrossRef
  9. Kim J.S, Lee S.H, Choi H.S, Kim M.K, Kwak H.R, and Cho J.D et al. (Array) Occurrence of virus diseases on major crops in. Res. Plant Dis 15, 1-7.
    CrossRef
  10. Kim J.S, Lee S.H, Choi H.S, Cho J.D, Noh T.H, and Kim J.Y. (2009b) Convenient genetic diagnosis of virion captured (VC)/RT-PCR for rice viruses (RSV, RBSDV) and small brown plant hopper. Res. Plant Dis 15, 57-62.
    CrossRef
  11. Kim J.S, Lee G.S, and Choi H.S. (2009c) Virus-insect-plant interaction at RSV outbreak regions in Korea. Workshop on the epidemics of migratory insect pests and associated virus diseases in rice and their impact on food security in APEC member economies , pp.62-74. Rural Development Administration, Suwon, Korea.
  12. Kim J.S, Lee G.S, Kim C.S, Choi H.S, Lee S.H, and Kim M.K et al. (2011) Severe outbreak of rice stripe virus and its occurring factors. Korean J.Pestic. Sci 15, 545-572.
  13. Kim J.Y, and Lee S.H. (2007) The distribution of heat waves and its cause in South Korea. J.Korean Geogr. Soc 42, 332-343.
  14. Kuribayashi K, and Shinkai A. (1952) On the new disease of rice, black-streaked dwarf. Phytopathol. Soc. Japan 16, 41.
  15. Kwon D.H, Jeong I.H, Hong S.J, Jung M.P, Kim K.S, and Lee S.W et al. (2018) Incidence and occurrence profiles of the small brown planthopper (Laodelphax striatellus Fallén) in Korea in 2011-2015. J.Asia-Pac. Entomol 21, 293-300.
    CrossRef
  16. Lee B.C, Hong Y.K, Hong S.J, Park S.T, and Lee K.W. (2005) Occurrence and detection of Rice black streaked dwarf virus in Korea. Plant Pathol. J 21, 172-173.
    CrossRef
  17. Lee J.Y, Lee S.H, and Chung B.J. (1977) Studies on the occurrence of rice black-streaked dwarf Virus in Korea. Korean J.Appl. Entomol 16, 121-125.
  18. Matsukura K, Towata T, Sakai J, Onuki M, Okuda M, and Matsumura M. (2013) Dynamics of Southern rice black-streaked dwarf virus in rice and implication for virus acquisition. Phytopathology 103, 509-512.
    Pubmed CrossRef
  19. Nasu S. (1963) Studies on some leafhoppers and planthoppers which transmit virus disease of rice plant in Japan. Bull. Kyushu Agric. Exp. Stn 8, 153-349.
  20. Otuka A. (2013) Migration of rice planthoppers and their vectored reemerging and novel rice viruses in East Asia. Front. Microbiol 4, 309.
    Pubmed KoreaMed CrossRef
  21. Otuka A, Matsumura M, Morimura S.S, Takeuchi H, Watanabe T, and Ohtsu R et al. (2010) The 2008 overseas mass migration of the small brown planthopper, Laodelphax striatellus, and subsequent outbreak of rice stripe disease in western Japan. Appl. Entomol. Zool 45, 259-266.
    CrossRef
  22. Park J.S, and Lee J.O. (1976) Studies on rice damage due to time of migration of the brown planthopper (Nilaparvata lugens) in Korea. Rice Entomol. News 4, 17.
  23. Park J.W, Jin T.S, Choi H.S, Lee S.H, Shin D.B, and Oh I.S et al. (2009) Incidence of Rice stripe virus during 2002 to 2004 in Korea and Chemical Control of Small Brown Plant Hopper. Korean J.Pestic. Sci 13, 309-314.
  24. Pham V.D, Cabunagan R.C, Cabauatan P.Q, Choi H.S, Choi I.R, and Ho V.C et al. (2007) Yellowing syndrome of rice:etiology, current status and future challenges. Omonrice 15, 94-101.
  25. ., RDA (Rural Development Administration) (2015). 2015 AFACI workshop on construction of epidemiology information interchange system for migratory disease and insect pest in Asia , pp.208. Rural Development Administration, Jeonju, Korea.
  26. Song Y. (1999) Development of Pest Surveillance System on Internet. Ministry of Agriculture. Food and Rural Affairs , 151.
  27. Song Y. (2007) Studies on the Prediction Models for the Outbreaks of the Long Range Migratory Planthoppers on Rice. Rural Development Administration , 96.
  28. ., The Korean Society of Plant Pathology (2009). List of Plant Diseases in Korea , pp.853. The Korean Society of Plant Pathology, Suwon, Korea.
  29. Zhou G.H, Wen J.J, Cai D.J, Li P, Xu D.L, and Zhang S.G. (2008) Southern rice black-streaked dwarf virus:a new proposed Fijivirus species in the family Reoviridae. Chinese Sci. Bull 53, 3677-3685.
    CrossRef


September 2018, 24 (3)