search for




 

Survey of the Routes and Incidence of Viral Infection of Tomato and Paprika Growing in Greenhouses in Cherwon Province, Korea During 2015-2017
Res. Plant Dis. 2018;24:145-152
Published online June 30, 2018
© 2018 The Korean Society of Plant Pathology.

HyungBae Kil1,†, Minji Kang2,†, Won-Seok Choi2,†, Joong-Il Kim2, Mi Sa Vo Phan3, JiHui Im1, MeeKyoung Kim1, and Mi-Ri Park2,*

1Cheorwon Agricultural Technology Center, Cheorwon 24023, Korea,
2Cheorwon Plasma Research Institute, Cheorwon 24047, Korea,
3School of Agricultural Biotechnology, Seoul National University, Seoul 08826, Korea
Tel: +82-33-452-9717 Fax: +82-33-452-5777 E-mail: mrpark@cpri.re.kr ORCID https://orcid.org/0000-0003-4101-7071
Received May 29, 2018; Revised June 4, 2018; Accepted June 15, 2018.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

During 2015-2017, we surveyed the incidence of viral infections of tomato and paprika growing in greenhouses in Cherwon province, Korea. In 2015 and 2016, we collected leaves and fruits from tomato and paprika plants growing in greenhouses. We detected viruses in the samples collected using specific primer sets for Broad bean wilt virus 2 (BBWV2), Cucumber mosaic virus (CMV), Pepper mild mottle virus (PMMoV), Pepper mottle mosaic virus (PepMoV), and Tomato spotted wilt virus (TSWV). We detected PMMoV, CMV, and TSWV in the samples, and CMV and TSWV were the most prevalent. For the prevention of future viral diseases, we then surveyed the routes of infection by these viruses in tomato and paprika plants growing in greenhouses in Cherwon province in 2017. Leaf and fruit samples were collected from seedlings and crops two and four months after transplanting into greenhouses. As a result, we found that TSWV was transferred from seedlings to plants, and outbreaks of the virus occurred at the early stage of cultivation. On the other hand, we found that CMV was a virus indigenous to the soil of some towns in Cherwon province, and thus outbreaks of this virus occurred at the middle stage of cultivation.

Keywords : Cheorwon province, Greenhouse, Paprika, Tomato, Viral infection
서론

강원도 철원지역은 토마토와 파프리카 등 과채류의 대규모 시설 하우스 재배 단지를 조성하고 있으며, 파프리카의 경우 우리나라의 여름작기 대부분이 철원지역에서 생산되고 있다. 철원지역의 시설 하우스 재배 과채류 중 파프리카는 지난 2003년을 시작으로 하여 2008년에 수출 100만불 시대를 가져올 만큼 효자 작물이다. 또한, 토마토와 고추 작물도 더불어 경제적으로 중요한 작물이 되고 있다. 철원지역은 우리나라에서 가장 추운 지역으로만 알려져 있으나, 내륙분지지역으로 겨울은 매우 춥고, 여름은 매우 더운 독특한 기후조건으로 토양 내 병원성 미생물이 월동을 하지 못하고, 식물병을 매개하는 해충의 유입의 한계로 비교적 병충해에 안전한 지역으로 알려져 있었다. 그러나 기후변화로 인해 2014년에 노지 고추에서 원인모를 병으로 일부 농가에서 커다란 경제적 손실을 입었고, Polymer chain reaction (PCR) 검출기법과 유전자 분석을 이용하여 식물병의 원인을 파악한 결과, 오이모자이크바이러스(Cucumber mosaic virus, CMV)에 의한 바이러스병임을 확인하였으며, 이는 철원지역에서 처음으로 보고된 사례이다(본 논문을 통해 첫 보고가 이루어짐).

CMV는 기주범위가 매우 넓고, 기계적 접촉에 의한 감염이나 진딧물과 같은 해충에 의한 전반이 가능하여 여러 주요 작물에 커다란 경제적 손실을 야기하는 바이러스로, 전 세계적으로 분포하고 있으며 이미 우리나라의 남부지역에서는 대발생되어 토착화되었다 (Cho 2007a; Choi 등, 2005; Francki 등, 1979; Palukaitis와 Garcia-Arenal, 2003a, 2003b).

본 연구는 CMV 검출을 계기로 하여, 철원지역에 분포하는 바이러스 종류를 조사하고 그 중 우점을 하고 있는 주요 바이러스의 유입 경로를 파악하기 위해 우리나라에서 문제가 되고 있는 바이러스인 고추마일드반점바이러스(Pepper mild mottle virus, PMMoV), 담배마일드녹색모자이크바이러스(Tobacco mild green mosaic virus, TMGMV), CMV, 고추얼룩바이러스(Pepper mottle virus, PepMoV), 잠두위조바이러스2(Broad bean wilt virus2, BBWV2), 토마토반점위조바이러스(Tomato spotted wilt virus, TSWV)를 포함한 16종의 바이러스들 중(Choi 등, 2002, 2005, 2010; Im 등, 1991; Ji 등, 2008; Kataya 등, 2008; Kim 등, 1990, 2011, 2012; Kwak 등, 2013; Lee 등, 2004; The Korean Society of Plant Pathology, 2009), 고추에 발생하는 5종의 RNA 바이러스(BBWV2, CMV, PepMoV, PMMoV, TSWV)를 대상으로 하여(Cho 등, 2007b), 2015년부터 2016년까지 철원지역의 주요 과채류인 파프리카와 토마토의 바이러스병 발생 실태조사를 진행하였다. 2017년에는 파프리카와 토마토 육묘, 정식 중기, 그리고 정식 후기의 작물의 잎과 과실을 채집하여 우점하고 있는 주요 바이러스의 유입경로와 감염율을 분석하고자 한다.

재료 및 방법

조사 지역 및 시료 채집

시설 하우스 재배 토마토와 파프리카를 대상으로 철원지역에 이미 유입되어 존재하고 있는 바이러스의 현황을 조사하기 위해, 2015년부터 2017년까지 철원지역의 6개 읍/면(갈말읍, 근남면, 김화읍, 동송읍, 서면, 철원읍)의 농가들을 방문하여 채집하였다. 2015년에는 20농가에서 바이러스병 감염이 의심되는 토마토와 파프리카의 잎과 과실을 포함하여 총 129개 시료를 채집하였고, 2016년에는 2015년에 채집한 농가를 포함하여 32농가에서 총 297개 시료를 채집하였다(Table 13). 2017년에는 작기별(육묘, 정식중기, 정식후기)로 나누어 채집을 하였고 1년간 총 49 채집농가에서 총 789개 시료(육묘: 480개 시료/48농가, 정식중기: 192개 시료/46농가, 정식후기: 117개 시료/33농가)를 채집하였다(Table 15). 2015년에는 CMV, TSWV, PepMoV, PMMoV의 총 4종에 대한 바이러스 검사를 실시하였고, 2016-2017년에는 2015년에 검사한 4종 바이러스에 현지 농가의 BBWV2 검사요청을 받아 BBWV2를 추가하여 총 5종에 대한 바이러스 검사를 실시하였다. 시료 채집 시기는 2015년과 2016년에는 7월부터 9월에 걸쳐 진행되었고, 2017년에는 육묘는 2월말부터 5월초, 정식을 하고 재배중기(육묘 채집 이후 2개월째)는 6월부터 7월, 정식후기(정식중기 채집 이후 2개월째)는 8월부터 9월에 걸쳐 채집을 진행하였다. 시료 채집 방법은 육묘기에는 바이러스병 의심 병징을 보이는 잎을 포함하여 무작위로 10개씩 육묘를 채집하였으며, 정식중기 및 후기에는 바이러스병으로 의심되는 병징을 나타내는 토마토와 파프리카의 잎이나 과실을 채집하였다. 육묘 이후, 시료 채집은 각 농가의 시설 하우스마다 바이러스병 의심 병징의 양상이 달라 시료 채집의 개수를 10개로 한정하지 않았다. 정식중기에는 46개 농가에서 바이러스 병을 보이는 시료를 채집하였으며, 정식후기에는 33개 농가에서 바이러스 병징을 보이는 시료를 채집하였다(Table 1). 바이러스병 발생 및 경로의 추적을 위해 같은 농가를 방문하여 작기별 3번 채집을 진행하였으나, 정식후기로 갈수록, 이미 바이러스병 피해를 크게 입은 농가들의 채집 거부로 작기 말로 갈수록 채집 농가 수가 줄었다.

The number of greenhouses for growing of tomato and paprika in Cheorwon province, Korea surveyed in 2015-2017

  Region201520162017-Seedling2017-Middle2017-End





TomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprika
Cheorwon-gun
Galmal-eup202110210191
Geunnam-myeon2225070706
Gimhwa-eup0202050504
Dongsong-eup234481381365
Seo-myeon23.35000000
Cheorwon-eup0213302020
Sub-total8121220212720261716

Total2032484633

Primers used in this study

 Virus  Primers  Primer sequences (5’ 3’)Size (bp)
CMVCMV CP-FATGGACAAATCTGAATCAAC654
CMV CP-RAGACTGGGAGCACTCCAG
TSWV1)TSWV CP-FGAGATTCTCAGAATTCCCAGT459
TSWV CP-RAGAGCAATCGTGTCAATTTTATTC
PMMoV2)PMMoV CP-FGTGTACTTCTGCGTTAGG395
PMMoV CP-RTTAAGGAGTTGTAGCCCACG
PepMoV3)PepMoV CP-FAGCGCTCAAGCTCAGACAC437
PepMoV CP-RCATATTTCTGACCCCAAGCAG
BBWV24)BBWV2-FCAGAGTTCAGTAGTTCCTGCTTATG238
BBWV2-RGGCATTTCAACCCTGCATAATAC

1)Mun et al., 2008,

2)Choi et al., 2005,

3)Lee et al., 2011,

4)Panno et al., 2014


Occurrence of viruses in greenhouses in Cheorwon province, Korea surveyed in 2015-2016

A. Tomato

RegionVirusTotal

CMVTSWVBBWV2PMMoVBBWV2Negative







20152016201520162015201620152016201520162015201620152016
Cheorwon-gun
 Galmal-eup32200070ND002124
 Geunnam-myeon70580000ND0021210
 Gimhwa-eup00000000ND00000
 Dongsong-eup05280040ND037920
 Seo-myeon21930000ND031145
 Cheorwon-eup02010000ND00003

 Total1210182000110ND06124742

ND : not detection
B. Paprika

RegionVirusTotal

CMVTSWVBBWV2PMMoVBBWV2Negative







20152016201520162015201620152016201520162015201620152016

Cheorwon-gun
 Galmal-eup04050000ND301013
 Geunnam-myeon7250340051ND0131363
 Gimhwa-eup021070000ND028236
 Dongsong-eup7228100021ND0101833
 Seo-myeon9231290070ND0241956
 Cheorwon-eup182213100100ND0113054

 Total411171011600242ND371782255

ND : not detection


Viral infection rate (%) in tomato and paprika in 2015 and 2016

VirusTotal

CMVTSWVBBWV2PMMoVBBWV2






201520162015201620152016201520162015201620152016
Tomato25.523.838.347.60.00.023.40.0ND0.087.271.4
Paprika50.045.912.245.50.00.029.30.8ND1.291.593.4

ND : not detection


Occurrence of viruses in greenhouses in Cheorwon province, Korea surveyed in 2017

A. Seedlings

 RegionVirusTotal

CMVTSWVPepMoVPMMoVBBWV2Negative







TomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprika
Cheorwon-gun
 Galmal-eup10190000000802010020
 Geunnam-myeon0000000000070070
 Gimhwa-eup00016000000034050
 Dongsong-eup20141000000778980130
 Cheorwon-eup00110000000190300

 Total303157000000176213210270

B. Crops two month after transplanting (middle stage)

 RegionVirusTotal

CMVTSWVPepMoVPMMoVBBWV2Negative







TomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprika

Cheorwon-gun
 Galmal-eup2010000000383413
 Geunnam-myeon0501000000011017
 Gimhwa-eup0500000100016022
 Dongsong-eup52001000000030393569
 Cheorwon-eup00000000005050

 Total730111000100736981111

C. Crops four month after transplanting (end stage)

 RegionVirusTotal

CMVTSWVPepMoVPMMoVBBWV2Negative







TomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprikaTomatoPaprika

Cheorwon-gun
 Galmal-eup0301000001330335
 Geunnam-myeon01200000000017029
 Gimhwa-eup070000000007014
 Dongsong-eup010200000017131716
 Cheorwon-eup00000000003030

 Total0230300000153375364

바이러스 검정

유전자 진단법(RT-PCR)을 이용하여 바이러스 검정을 하였다. 채집한 시료(잎과 과실)를 액체질소를 이용해 분쇄한 후, Total RNA Isolation TRIZOL Reagent (MRC, USA)를 이용하여 total RNA을 추출하였다(Kang 등, 2016). 그리고 cDNA를 합성하기 위하여 PrimeScript Reverse Transcriptase (Takara Bio, Japan)와 Random primer (NNNNNN)를 이용하여 cDNA을 합성하였고 Takara TaqTM (TakaraBio, Japan)과 5종의 바이러스에 대한 특이 프라이머(Table 2)를 이용하여 PCR을 하였다. PCR의 반응 조건은 CMV와 PMMoV의 경우, 94°C, 1분; <94°C, 30초; 50°C, 40초; 72°C, 17초> 35 cycles; 72°C, 10분, BBWV2의 경우, 94°C, 1분; <94°C, 30초; 58°C, 40초; 72°C, 17초> 35 cycles; 72°C, 10분, TSWV의 경우, 94°C, 1분; <94°C, 30초; 52°C, 40초; 72°C, 17초> 35 cycles; 72°C, 10분, 그리고 PepMoV의 경우, 94°C, 1분; <94°C, 30초; 54°C, 40초; 72°C, 17초> 35 cycles; 72°C, 10분이며, 각 PCR 산물은 1% agarose gel에서 전기영동을 수행하여 바이러스 감염 여부를 확인하였다. 검출된 PCR 산물은 염기서열분석을 통해 최종 바이러스 유전자 여부를 확인하였다.

결과 및 고찰

2015-2016년 토마토와 파프리카 바이러스병 발생조사

철원지역 시설 하우스에서 재배하는 토마토와 파프리카를 대상으로 바이러스병 발생 현황과 감염 바이러스의 종류를 조사하기 위하여 2015년과 2016년 7월부터 9월까지 철원군의 6개의 읍/면에 소재하는 토마토와 파프리카 재배 농가에서 시료를 채집하였다. 2015년에 토마토 재배 농가 8곳에서 채집한 시료 47개 중에서 바이러스 감염 시료는 41개였고, 파프리카 재배 농가 12곳에서 채집한 시료 82개 중에서 바이러스 감염 시료는 75개였다(Table 13). 2016년에는 토마토 농가 12곳에서 채집한 42개의 시료 중에서 30개에서 바이러스가 검출되었으며, 파프리카 농가 20곳에서 채집한 255개의 시료 중, 바이러스가 검출된 시료는 238개였다(Table 13). 이를 토대로 하여, 작물별 바이러스 전체 감염율을 분석한 결과, 2015년에 총 4종의 바이러스를 검정하여 토마토는 87.2%, 파프리카는 91.5%의 바이러스 감염율을 보였으며, 2016년에는 5종의 바이러스를 검정하여 토마토에서 71.4%, 파프리카에서 93.4%의 감염율을 보였다(Table 4). 바이러스 종류별 감염율을 분석한 결과, 2015년에는 토마토 시료 중에서 CMV 감염율은 25.5%, TSWV는 38.3%, PepMoV는 0%, PMMoV는 23.4%로, TSWV에 의한 바이러스병의 발생이 높았고, 파프리카 시료에서 바이러스 감염율은 CMV가 50.0%, TSWV가 12.2%, PepMoV가 0%, PMMoV가 29.3%로 CMV에 의한 바이러스병 발생이 높게 나타냈다(Table 4). 2016년에는 토마토의 바이러스별 감염율은 CMV 23.8%, TSWV 47.6%였으며, 파프리카의 바이러스별 감염율은 CMV 45.9%, TSWV 45.5%, PMMoV 0.8%, BBWV2 1.2%로 나타났다(Table 4). 채집한 시료들 중, 일부 복합 감염이 있었고, 본 결과에서는 복합 감염을 각 바이러스 감염 결과에 중복으로 표기하였다(Table 35). 조사 결과를 토대로 2015년과 2016년의 작물별 바이러스병 발생의 경향을 분석하면, 토마토의 경우, 2015년에는 PMMoV가 검출되었으나 2016년에는 검정이 되지 않았고, CMV 감염율은 1.7%로 감소하였으며, TSWV 감염율은 9.3%로 증가함을 나타내었다. 반면에 파프리카의 경우, 2015년에 비해 2016년에 TSWV의 감염율이 33.3%로 크게 증가하였고, CMV는 4.1%로 소폭 감소하였으며, PMMoV는 28.5%로 발병율이 크게 감소하였고, 2016년에는 BBWV2를 추가로 검정하여 처음 검출되었다(Table 4). 따라서, 2년간 바이러스병 발생 양상을 보면, 두 작물에서 2016년도에 TSWV에 의한 바이러스병 발생이 급격히 증가하였고, CMV에 의한 병은 소폭 감소하였으며, PMMoV는 거의 발생하지 않았다. BBWV2의 경우, 2015년에는 검출하지 않았으나 2016년에 농가의 요청으로 검출한 결과, 특정 농가에서 검출되었다.

2017년 토마토, 파프리카 바이러스병 발생조사(육묘-정식중기-정식후기)

2015년과 2016년, 2년 동안 철원지역에서의 바이러스병 발생 현황과 분포하는 바이러스의 종류를 동정하였다. 그 결과, CMV에 의한 바이러스병의 발생은 감소하였지만 지속적으로 병이 발생하고 있었으며, 반면에 TSWV에 의한 바이러스병은 급속도로 확산되고 있었음을 알 수 있었다. 철원 지역에 우점하고 있는 CMV와 TSWV임을 확인하였고, 바이러스별 철원지역에 유입 경로를 조사하기 위해 2017년에는 작기별로 정식전 육묘장에서 공급받은 육묘, 육묘를 정식하고 2달 후(정식중기), 정식중기에 채집하고 2달 후(정식후기)의 시료를 각각 채집하여 바이러스병 발생 및 유입 경로를 조사하였다. 그 결과, 육묘에서 토마토 농가 21곳에서 채집한 시료 210개 중에서 유전자검출법으로 바이러스 감염을 확인한 결과, 감염시료는 34개였고, 파프리카 농가 27곳에서 채집한 시료 270개 중에서 바이러스 감염시료는 57개였다(Table 1과 5A). 정식중기에는 토마토 농가 20곳에서 채집한 시료 81개 중에서 바이러스 감염시료는 8개였고, 파프리카 농가 26곳에서 채집한 시료 111개 중에서 바이러스 감염시료는 42개였다(Table 5B). 정식후기에는 토마토 농가 17곳에서 채집한 시료 53개 중에서 바이러스 감염시료는 0개였고, 파프리카 농가 16곳에서 채집한 시료 64개 중에서 바이러스 감염시료는 27개였다(Table 5C).

2017년도 각 작기에서 작물별 총 5종의 바이러스 감염율은 토마토에서 육묘 16.2%, 정식중기 9.8%, 정식후기 0.0%로 나타났으며, 파프리카에서 육묘 21.1%, 정식중기 37.8%, 정식후기 42.2%로 나타났다(Table 6). 바이러스별 감염율을 분석한 결과, 토마토에서 CMV 감염율은 육묘 1.4%, 정식중기 8.6%, 정식후기 0%이고, TSWV의 감염율은 육묘 14.8%, 정식중기 1.2%, 정식후기 0%이고, PepMoV, PMMoV와 BBWV2는 2017년에 검출되지 않았다(Table 6). 파프리카에서는 CMV의 감염율은 육묘 0%, 정식중기 27.0%, 정식후기 35.9%이고, TSWV의 감염율은 육묘 21.1%, 정식중기 9.9%, 정식후기 4.7%이며, PMMoV의 감염율은 육묘 0%, 정식중기 0.9%, 정식후기 0%이며, BBWV2의 감염율은 육묘 0%, 정식중기 0%, 정식후기 1.6%으로 나타났으며 PepMoV는 2017년에 검출되지 않았다(Table 6). 전체적인 2017년도 주요 바이러스병 발생을 검출 시료 수로 분석해 보면, CMV의 경우 시간이 지날수록 감염율이 증가하였다가 작기가 끝나갈수록 서서히 감소하였고(Fig. 1A), TSWV의 경우 작기가 끝나갈수록 급격히 감소하는 양상을 보였다(Fig. 1B). 두 바이러스 모두 작기 말에 감소하는 경향은 바이러스 실태조사를 하면서, 바이러스병 방제에 도움이 된 것으로 보이며 조기 방제의 효과 및 중요성을 확인할 수 있었다.

Viral infection rate (%) in tomato and paprika in 2017

SeedlingsMiddle stageEnd stage



TomatoPaprikaTomatoPaprikaTomatoPaprika
CMV1.40.08.627.00.035.9
TSWV14.821.11.29.90.04.7
PepMoV0.00.00.00.00.00.0
PMMoV0.00.00.00.90.00.0
BBWV20.00.00.00.00.01.6

Total16.221.19.837.80.042.2

Fig. 1.

The number of virus-infected samples that were collected from seedlings and crops two and four months after transplanting into greenhouses in Cheorwon province, Korea in 2017. (A) The number of CMV-infected and (B) TSWV-infected samples that were collected from seedlings and crops two (middle stage) and four (end stage) months after transplanting into greenhouse, respectively. Outbreaks of CMV occurred at the middle stage of cultivation in the greenhouses in Cheorwon province. TSWV was transferred from seedlings to plants, and outbreaks of the virus occurred at the early stage of cultivation.


2017년 과채류(토마토, 파프리카) 바이러스병 유입경로 추적

2015-2016년 철원지역의 주요 과채류인 토마토와 파프리카를 대상으로 4-5종의 주요 고추바이러스에 대한 바이러스병 실태조사를 실시한 결과, 과채류에 감염된 주요 바이러스는 TSWV와 CMV임을 확인하였고, 2년간 CMV에 의한 바이러스병은 서서히 감소하고 있지만 여전히 발생하고 있고, 반면에 TSWV에 의한 바이러스병은 급속하게 증가하였다(Table 4). 이에 따라, 2017년에 이들 주요 바이러스에 대한 유입 경로를 파악하기 위해 작기별 바이러스병 발생 추이를 조사하였으며, 각 작기별 채집한 시료를 유전자 진단법으로 바이러스를 검정한 결과, TSWV는 육묘에서 주로 검출되었고(Fig. 1A), CMV는 육묘에서는 거의 검출되지 않다가 정식중기때 급속하게 확산되어 있었다(Fig. 1B). 이는 토마토와 파프리카 모두에서 같은 양상을 보였다. 육묘 채집 시기는 육묘장에서 농가로 도착한 육묘를 무작위로 채집하여 바이러스 검정을 실시한 것이었고, 철원지역의 육묘는 대부분 관외지역의 육묘장의 육묘를 이용하고 있었다.

본 연구에서는 철원지역의 TSWV에 의한 바이러스병은 관외 육묘에서부터 유입되어 병의 확산이 이루어지고 있음을 확인하였으며, 2017년 바이러스 실태조사를 진행하면서, 육묘 시료에서 바이러스가 검출된 농가에게 바이러스병에 대한 지속적인 관찰을 유도한 결과, TSWV의 검출이 급감함을 확인하였다(Fig 1B). 그러나 육묘장에서 감염이 이루어진 것인지 종자 채종시 감염된 종자가 원인인지는 본 연구에서는 확인할 수 없고, 정확한 원인을 위해 향후 연구가 필요할 것으로 보인다. 반면에 CMV는 육묘에서는 검출이 미미하였지만 작기중기때 채집한 시료에서 급속하게 확산됨을 확인하였다(Fig. 1A). 따라서, CMV의 경우, 육묘가 아닌 농가에서 재배 중에 시설 하우스의 바이러스에 오염된 잔재물 및 진딧물 등 매개충에 의한 오염원을 시작으로 병의 확산이 이루어짐을 알 수 있었다(Fig 1A). 결과를 토대로 하여, 철원지역에서 2014년을 시작으로 2015년에서 2017년까지 지속적으로 CMV에 의한 바이러스병이 발생하고 있는 원인이 지역에 토착화된 것이었음을 확인할 수 있었다.

본 연구에서는 철원지역의 바이러스병 발생의 현황과 바이러스 5종에 대한 철원내 지역을 구분하여 분포를 조사하였다. 그 결과 CMV와 TSWV, 2종의 바이러스가 우점하고 있음을 확인하였고, CMV의 경우, 토착화에 의한 지속적인 감염을, TSWV의 경우, 외부에서 유입되어 감염이 이루어지고 있음을 확인하였다. 본 연구에서는 RNA 바이러스에 한정하여 조사가 진행되었으며, 향후 TYLCV와 같은 DNA 바이러스병 발생의 현황에 대한 조사가 필요할 것으로 보인다.

요약

철원지역의 주요 과채류인 토마토와 파프리카를 대상으로 바이러스병 발생 현황을 조사하고 바이러스병에 대한 방제를 위해 2015년부터 2017년까지 시설 하우스를 중심으로 조사를 실시하였다. 2015년-2016년에는 7-9월에 채집을 진행하였고, 채집시료는 시설 하우스에서 재배되고 있는 토마토와 파프리카의 잎과 과실이었다. 파프리카와 토마토를 포함하는 가지과 작물에 주요 바이러스병을 일으키는 5종의 바이러스인 Pepper mild mottle virus (PMMoV), Cucumber mosaic virus (CMV), Pepper mottle virus (PepMoV), Broad bean wilt virus 2 (BBWV2), Tomato spotted wilt virus (TSWV)에 대하여 유전자 진단법을 이용하여 채집시료를 검정하였다. 그 결과, PMMoV, CMV, 그리고 TSWV가 검출되었으며, 이들 중, CMV와 TSWV에 의한 바이러스병이 대부분(2015년에 파프리카에서 CMV 검정률 50.0%, TSWV 12.2%, 토마토에서 CMV 25.5%, TSWV 38.3% 이고, 2016년에 파프리카에서 CMV 45.9%, TSWV 45.5%, 토마토에서 CMV 23.8%, TSWV 47.6%)을 차지하고 있었다. 이 두 바이러스의 조기예방을 위한 발생 경로를 추적하기 위하여 2017년에는 작기별(육묘, 정식중기, 정식후기)로 채칩 시기를 나누어 바이러스 검정을 실시하였다. 조사 결과, TSWV는 육묘에 감염되어 외부에서 철원군내에 유입되어 초기 병발생율이 높았고, CMV는 철원군내 농가에 토착화되어 작기가 중반으로 넘어갈수록 병발생율이 높게 나타난 것으로 확인되었다. 또한 2017년도 작기별 바이러스병 발생 현황 조사 결과, TSWV에 의한 바이러스병 발생율이 육묘에서 검출 이후 점점 감소하는 현상은 본 연구를 통해 육묘때 조기진단으로 인한 바이러스 검출 농가의 조기 대응 및 지속적인 관찰이 바이러스병의 확산 방지에 중요한 역할을 한 결과로 보인다.

Conflicts of Interest

No potential conflict of interest relevant to this article was reported.

Acknowledgement

This research was supported by a grant from the Research Program of Cheorwon Agricultural Technology Center, Cheorwon-gun, Republic of Korea.

References
  1. Cho JD, Kim JS, Lee SH, and Choi GS. (2007a) Viruses and symptoms on peppers, and their infection types in Korea. Res. Plant Dis 13, 75-81.
    CrossRef
  2. Cho JD, Lee SH, Kim JS, Choi GS, and Chung BN. (2007b) Study of incidence on peppers viruses in Korea. BioWave 9, 1.
  3. Choi GS, Kim JH, Lee DH, Kim JS, and Ryu KH. (2005) Occurrence and distribution of viruses infecting pepper in Korea. Plant Pathol. J 21, 258-261.
    CrossRef
  4. Choi GS, Kim JH, Ryu KH, Choi JK, Chae SY, and Kim JS et al. (2002) First report of tobacco mild green mosaic virus infecting pepper in Korea. Plant Pathol. J 18, 323-327.
    CrossRef
  5. Choi HS, Lee SH, Kim MK, Kwak HR, Kim JS, and Cho J. D et al. (2010) Occurrence of virus diseases on major crops in 2009. Res. Plant Dis 16, 1-9.
    CrossRef
  6. Francki R. I. B, Mossop DW, and Hatta T. (1979). Cucumber mosaic virus. CMI/AAB Descriptions of Plant Viruses 213 .
  7. Im KH, Chung BK, Yoon JY, and Green SK. (1991) A survey on viruses infecting peppers (Capsicum annum) in Korea by microplate method of enzyme-linked immunosorbent assay (ELISA). Korean J. Plant Pathol 7, 251-256.
  8. Ji J, Oh TK, Lee HJ, Kim SH, Rajangam U, and Kim SC et al. (2008) Molecular characterization of tomato infecting Tobacco leaf curl geminivirus isolated from Jeju island. Res. Plant Dis 14, 238.
  9. Kang M, Seo JK, Choi H, Choi HS, and Kim KH. (2016) Establishment of a simple and rapid gene delivery system for cucurbits by using engineered Zucchini Yellow Mosaic Virus. Plant Pathol. J 32, 70-76.
    Pubmed KoreaMed CrossRef
  10. Kataya A. R. A, Stavridou E, Farhan K, and Livieratos IC. (2008) Nucleotide sequence analysis and detection of a Greek isolate of tomato chlorosis virus. Plant Pathol 57, 819-824.
    CrossRef
  11. Kim JS, Kim SK, Lee SH, and Lee MW. (1990) A pepper vein chlorosis virus causing stem necrosis and vein chlorosis on red pepper in Korea. Korean J. Plant Pathol 6, 376-381.
  12. Kim JS, Lee SH, Choi HS, Kim MK, Kwak HR, and Kim J. S et al. (2012) 2007-2011 characteristics of plant virus infections on crop samples submitted from agricultural places. Res. Plant Dis 18, 277-289.
    CrossRef
  13. Kim JS, Lee SH, Choi HS, Kim MK, Kwak HR, and Nam M et al. (2011) Occurrence of virus diseases on major crops in 2010. Res. Plant Dis 17, 334-341.
    CrossRef
  14. Kwak HR, Kim MK, Nam M, Kim JS, Kim KH, Cha B, and Choi HS. (2013) Genetic composition of broad bean wilt virus 2 infecting red pepper in Korea. Plant Pathol. J 29, 274-284.
    Pubmed KoreaMed CrossRef
  15. Lee MY, Song YS, and Ryu KH. (2011) Development of infectious transcripts from full-length and GFP-tagged cDNA clones of pepper mottle virus and stable systemic expression of GFP in tobacco and pepper. Virus Res 155, 487-494.
    Pubmed CrossRef
  16. Lee SH, Lee JB, Kim SM, Choi HS, Park JW, and Lee J. S et al. (2004) The incidence and distribution of viral diseases in pepper by cultivation types. Res. Plant Dis 10, 231-240.
    CrossRef
  17. Mun HY, Park MR, Lee HB, and Kim KH. (2008) Outbreak of cucumber mosaic virus and tomato spotted wilt virus on bell pepper grown in Jeonnam Province in Korea. Plant Pathol. J 24, 93-96.
    CrossRef
  18. Palukaitis P, and Garcia-Arenal F. (2003a). Cucumber mosaic virus. CMI/AAB Descriptions of Plant viruses 400 .
  19. Palukaitis P, and Garcia-Arenal F. (2003b) Cucumoviruses. Adv. Virus Res 62, 241-323.
    CrossRef
  20. Panno S, Ferriol I, Rangel EA, Olmos A, Han CG, and Martinelli F et al. (2014) Detection and identification of Fabavirus Species by one-step RT-PCR and multiplex RT-PCR. J. Virol. Methods 197, 77-82.
    Pubmed CrossRef
  21. ., The Korean Society of Plant Pathology (2009). List of plant diseases in Korea , pp.853. The Korean Society of Plant Pathology, Seoul, Korea.


September 2018, 24 (3)