search for




 

First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Peach Trees in South Korea
Res. Plant Dis. 2017;23:75-81
Published online March 31, 2017
© 2017 The Korean Society of Plant Pathology.

Sangmin Bak1, Euncheol Seo1, San Yeong Kim1, Won Heum Park1, and Su-Heon Lee2,3,*

1Cheongdo Peach Research Institute, Gyeongsangbuk-do Agricultural Research & Extension Services, Cheongdo 38315, Korea,
2School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea,
3Institute of Plant Medicine, Kyungpook National University, Daegu 41566, Korea
Tel: +82-53-950-5763 Fax: +82-53-950-6758 E-mail: suheon@knu.ac.kr
Received October 29, 2016; Revised January 17, 2017; Accepted January 18, 2017.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

In May 2016, 24 peach samples showing abnormal and virus like symptoms were collected in one of major peach producing area, Yeongcheon-si, Gyeongsangbuk-do, Korea. We performed RT-PCR diagnosis for confirmation of viral infection. The diagnostic targets are 17 species of viruses and viroids that quarantine and high risk pathogens when it occur. As a results, seven species of viruses and viroids, including an unreported (Apricot pseudo-chlorotic leaf spot virus, APCLSV) and a quarantine (Peach latent mosaic viroid, PLMVd) species in Korea, were detected. For the sequence analysis of unreported virus, APCLSV, the sequence of coat protein gene were amplified and cloned. The sequence showed 97% nucleotide identity with other APCLSV isolates and compared with other seven species of reported Trichoviruses. This virus was classified as APCLSV based on the sequence and phylogenetic analysis. This isolate was named Yeongcheon. As patterns of APCLSV occurrence, all samples that APCLSV detected were co-infected with Apple chlorotic leaf spot virus (ACLSV). As properties of ACLSV, APCLSV has high possibility of wide spread disease in fruit tree farms in Korea. Therefore, it is necessary to do related researches, such as infection route and influence of disease in commercial orchards.

Keywords : APCLSV, Apricot pseudo-chlorotic leaf spot virus, Peach, RT-PCR diagnosis, Trichovirus
서론

복숭아(Punus persica)는 장미과(Rosaceae) 벚나무속(Prunus)에 속하며, 우리나라의 총 재배면적은 19,303 ha로(국가통계포털, 2016), 사과, 배, 감과 함께 주요 경제과수이다. 7종의 바이러스와 바이로이드(Apple chlorotic leaf spot virus [ACLSV], Apple stem grooving virus [ASGV], Cucumber mosaic virus [CMV], Hop stunt viroid [HSVd], Little cherry virus 1 [LChV-1], Peach latent mosaic viroid [PLMVd], Prunus necrotic ringspot virus [PNRSV])가 국내 복숭아에 보고되어 있다(Cho 등, 2012; Jo 등, 2016a, 2016b; Lee 등, 2004; Lim 등, 2015; Park, 2015). Apricot pseudo-chlorotic leaf spot virus (APCLSV)는 Trichovirus에 속하며, 이탈리아에서 처음 보고되었다(Liverti 등, 2005). APCLSV를 포함하여, 총 7종의 바이러스가 Trichovirus로 분류되어 있다(Fauquet 등, 2005). 이 바이러스는 기계적 접종, 접목 등에 의해 전파되며, 매개체는 구체적으로 밝혀지지 않았다(Liverti 등, 2005). APCLSV는 이탈리아에서 처음 보고된 이후 중국에서 보고되었으나(Niu 등, 2012), 국내에서는 아직까지 보고되지 않았다. 따라서 이번 연구에서 확인한 바이러스의 국내 발생 여부를 보고한다.

본론

시료 채집

2016년 5월, 우리나라 주요 복숭아 재배 산지인 경북 영천 지역의 복숭아 재배 농가에서 퇴록(chlorosis), 괴저반점(necrotic spot), 엽맥퇴록(vein clearing), 황화(yellowing) 등 이상증상과 바이러스 병징(Fig. 1)을 보이는 복숭아 잎 24점을 채집하였다. 채집된 시료는 털복숭아 8품종(천중도, 치요마루, 진미, 미홍, 미황, 사쿠라, 수미, 유명)에서 19점, 천도복숭아 변종(P. persica var. nucipersica) 2품종(천홍, 수홍)에서 5점이다(Table 1). 수집한 시료는 동결 건조하여 초저온 냉동고(–70°C)에 보관하며 추가적인 실험에 사용하였다.

Fig. 1.

Collected samples showing virus like symptoms on peach (Prunus persica) leaves in Yeongcheon-si area. These samples were collected in formative period of shoots. (A) Chlorosis. (B) Yellowing. (C, D) Vein clearing. (E, F) Chlorosis.


List of primer pairs for RT-PCR detection of viruses and viroids

 Target virusAcronymOligo nameOligo sequence (5’-3’)*Size (bp)Reference
American plum line pattern virusAPLPVAPLPV1GACGAGGCTGATGAAGGGAA501Cheong et al., 2015
APLPV1ACCCACAGAAGGACCTACCA
Apple chlorotic leaf spot virusACLSVACLSV-F31GCAGACCCCTTCATGGAAAGA509Bae, 2015
ACLSV-R31CGCAAAGATCAGTCGTAACAGA
Apple stem pitting virusASPVASPV-F001AAGCATGTCTGGAACCTCATG367Bae, 2015
ASPV-R001-2GATCAACTTTACTAAAAAGCATAAGT
Apple stem grooving virusASGVASGV-senseGCCACTTCTAGGCAGAACTCTTTGAA273Menzel et al., 2002
ASGV-antisenseAACCCCTTTTTGTCCTTCAGTACGAA
Apple skin scar viroidASSVdASSVd-F91ACGAAGGCCGGTGAGAAAG202Bae, 2015
ASSVd-R291CCGCTGCGTCAAAGAAAAAG
Apple mosaic virusApMVApMV-F5CTCCAAACACAACTTTTGATGACTT123Bae, 2015;
ApMV-antisenseGTAACTCACTCGTTATCACGTACAAMenzel et al., 2002
Apricot pseudo-chlorotic leaf spot virusAPCLSVAPCLSV-F2TGGTTAGGTCCAATAACTCC1,288Niu et al., 2012
APCLSV-R2GGATGATCCTGGTTTGACAG
Cherry green ring mottle virusCGRMVCGSp-FGCGCAAACGGACCCTAAG650Lee et al., 2014
CGSp-RCGCCAGTCACTTCAGTCATT
Cherry necrotic rusty mottle virusCNRMVCNSp-FCTTTGATCCCAAAAATCCCA210Lee et al., 2014
CNSp-RTGGTYTTGTCACTTGAACTGTT
Cucumber mosaic virusCMVCMR-C30CCACACGGTAGAATCAAAT850Park, 2015
CMR-N40GCTCGCCTGTTGAAGTCGCA
Hop stunt viroidHSVdVP19GCCCCGGGGCTCCTTTCTCAGGTAAG297Kofalvi et al., 1997
VP20CGCCCGGGGCAACTCTTCTCAGAATCC
Little cherry virus 1LChV-1LCUW7090GGTTGTCCTCGGTTGATTAC300Bajet and Unruh, 2008
LCUWc7389GGCTTGGTTCCATACATCTC
Little cherry virus 2LChV-2LC26LGCAGTACGTTCGATAAGAG409Bajet and Unruh, 2008
LC26RAACCACTTGATAGTGTCCT
Peach latent mosaic viroidPLMVdPLMVd-F214CCGTAGAAACTGGATTACGACGTCT278Designed for this study
PLMVd-R155CCTTACGTCATTGCGAGGTGCTTA
Plum bark necrosis stem pitting-associated virusPBNSPaVPBN195FCTGGTCTTCCTGCTACTCCTT195Cui and Hong, 2011
PBN196RAAGCCCACAATCTCAGAGCG
Plum pox virusPPVPPV-F9240ATTATGGCACATTTCAGTAACGT348Designed for this study
PPV-R9587TGATAGATACCGAGACCACT
Prunus necrotic ringspot virusPNRSVPNRSV-P1ATGGTTTGCCGAATTTGCAA675Kim et al., 2009
PNRSV-P2CTAGATCTCAAGCAGGTCTT

*Degenerate sequence: Y=C+T.


전체 RNA추출 및 RT-PCR 진단

채집된 복숭아 시료에 감염된 바이러스를 확인하기 위해 easy-spin™ Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea)를 이용하여 제공사의 매뉴얼대로 전체 RNA (total RNA)를 추출하였다. 진단 대상은 검역 병원체로 지정된 바이러스 또는 바이로이드를 중심으로, 국내외 연구를 참고하여 국내 발생가능성이 높거나 발생 시 위험도가 높은 종 17종(American plum line pattern virus [APLPV], ACLSV, Apple stem pitting virus [ASPV], ASGV, Apple skin scar viroid [ASSVd], Apple mosaic virus [ApMV], APCLSV, Cherry green ring mottle virus [CGRMV], Cherry necrotic rusty mottle virus [CNRMV], CMV, HSVd, LChV-1, Little cherry virus 2 [LChV-2], PLMVd, Plum bark necrosis stem pitting-associated virus [PBNSPaV], Plum pox virus [PPV], PNRSV)이다. 진단 방법은 기존에 발표된 연구(Bae, 2015; Bajet과 Unruh, 2008; Cheong 등, 2015; Cui와 Hong, 2011; Kim 등, 2009; Kofalvi 등, 1997; Lee 등, 2014; Menzel 등, 2002; Niu 등, 2012; Park, 2015)에서 사용되거나, 새로이 종 특이적으로 설계된 프라이머(Table 1)를 이용한 one-step RT-PCR 진단법이다. 양성 반응을 보인 RT-PCR 산물을 마크로젠(Macrogen, Seoul, Korea)사에 의뢰하여 direct sequencing하여 증폭 산물이 해당 바이러스 및 바이로이드의 염기서열임을 확인하였다(data not shown). 진단 결과, 5종의 바이러스와 2종의 바이로이드가 검출되었다. 검출된 바이러스는 ACLSV, APCLSV, CGRMV, PBNSPaV, PNRSV이며, 바이로이드는 HSVd, PLMVd이다. 특히, 모든 시료에서 PLMVd가 검출되었다. 국내 복숭아에 보고된 적이 없는 APCLSV, CGRMV, PBNSPaV가 처음으로 검출되었으며, APCLSV의 경우 복숭아 이외의 다른 식물체에서도 보고된 바 없다. 국내 복숭아에서 발생하는 것으로 알려진 ACLSV, HSVd, PLMVd, PNRSV는 이번 실험에서도 발생을 확인할 수 있었으나, ASGV, CMV, LChV-1는 검출되지 않았다(Table 2).

Detection of viruses and viroids infecting peaches by RT-PCR diagnosis

No. of samplesSymptomResult of RT-PCR diagnosis

APLPVACLSVASPVASGVASSVdApMVAPCLSVCGRMVCNRMVCMVHSVdLChV-1LChV-2PLMVdPBNSPaVPPVPNRSV
1ch+++
2ch++
3ch++
4ch+++++
5ch+++++
6ns++++
7ch++
8ch+
9ch+++++
10ch+++++
11ch++++
12vc++++
13vc+++++
14ch++++++
15ch+++++
16ch++++
17ye+
18ch++++
19mo++
20vc++
21ch++++
22ch+++
23ch+++
24ch, ye+
Infection rate (%)079.2000045.84.20045.80010058.308.3

ch, chlorosis; ns, necrotic spot; vc, vein clearing; ye, yellowing; mo, mosaic; APLPV, American plum line pattern virus; ACLSV, Apple chlorotic leaf spot virus; ASPV, Apple stem pitting virus; ASGV, Apple stem grooving virus; ASSVd, Apple skin scar viroid; ApMV, Apple mosaic virus; APCLSV, Apricot pseudo-chlorotic leaf spot virus; CGRMV, Cherry green ring mottle virus; CNRMV, Cherry necrotic rusty mottle virus; CMV, Cucumber mosaic virus; HSVd, Hop stunt viroid; LChV-1, Little cherry virus 1; LChV-2, Little cherry virus 2; PLMVd, Peach latent mosaic viroid; PBNSPaV, Plum bark necrosis stem pitting-associated virus; PPV, Plum pox virus; PNRSV, Prunus necrotic ringspot virus; +, positive reaction; –, negative reaction.


외피단백질 염기서열 증폭

RT-PCR 진단에서 APCLSV 특이적 프라이머에 양성을 보인 전체 RNA를 SuperiorScript III cDNA Synthesis Kit (Enzynomics, Daejeon, Korea)와 18개의 thymine으로 구성된 Oligo dT(18) 프라이머를 이용하여, cDNA를 합성하였다. 또, 외피단백질 염기서열을 증폭하기 위해 National Center for Biotechnology Information (NCBI)의 GenBank에 기보고된 APCLSV 염기서열을 이용하여 2쌍의 프라이머를 설계하여 nested PCR에 이용하였다(outer pair: APCLSV-F6505, 5’-GTA AAA GAG AGA AGG AGG AG-3’; APCLSV-R7448, 5’-CAC TCC AAT ATT GGT TAG GAC-3’; inner pair: APCLSV-F6596, 5’-CAG CGA GTG AGG ATG AAT C-3’; APCLSV-R7421, 5’-CTC CTT TGA TAA ACT GGG AC-3’). 합성된 cDNA를 BioFACT™ Lamp Taq DNA Polymerase (BioFact, Daejeon, Korea)를 이용하여 제공사의 매뉴얼대로 증폭하였다.

외피단백질 염기서열 결정 및 유연관계 분석

증폭된 PCR 산물을 EZ-Pure™ PCR/Gel Duo Kit (Enzynomics)를 이용하여 정제한 뒤 Park 등(2011)의 방법으로 클로닝하였다. X-gal이 포함된 배지 상에 형성된 백색 콜로니 중 벡터에 삽입된 염기서열 길이가 일치하는 콜로니를 배양하였다. 배양된 산물에서 플라스미드를 추출하여 마크로젠에 의뢰하여 염기서열을 결정하였다. 염기서열 분석에는 DNAMAN 7.0 프로그램(Lynnon Biosoft, Quebec, QC, Canada)을 사용하였다. 최종 결정된 염기서열을 GenBank에서 Blast한 결과 중국에서 보고된 APCLSV 분리주(accession no. JN873309)와 98%, 이탈리아에서 보고된 APCLSV 분리주(accession no. AY713380)와 97% 상동성을 보였다(data not shown). 또, Trichovirus 7종의 바이러스의 외피단백질 염기서열 유연관계를 분석한 결과, 이탈리아에서 복숭아와 자두에서 검출된 두 분리주와 가장 높은 유연관계를 가지는 것을 확인할 수 있었다(Fig. 2). 또, 이 염기서열에 기반하여, 외피단백질의 아미노산 서열을 기보고된 APCLSV 두 분리주(accession nos. AY713380, NC_006946)와 비교하였다. 기보고된 두 분리주는 각각 복숭아와 자두에서 보고되었으며, 두 분리주 사이의 외피단백질의 염기서열 및 아미노산 서열은 서로 100% 일치한다. 이 두 분리주와 이번 연구에서 밝혀진 분리주는 각각 95.34%의 아미노산 상동성을 보였다(Fig. 3). 따라서 이번 연구에서 밝혀진 사실들을 바탕으로 바이러스를 APCLSV로 동정하고 Yeongcheon 분리주로 명명하였다. 결정된 외피단백질 염기서열은 NCBI GenBank에 등록하였다(accession no. KX768275).

Fig. 2.

Phylogenetic analysis of Trichoviruses, including Apricot pseudo-chlorotic leaf spot virus (APCLSV) isolate Yeongcheon based on coat protein (CP) genes. The phylogenetic trees were generated by maximum likelyhood method with 100,000 bootstrap replicates by DNAMAN 7.0 software (Lynnon Biosoft, Canada). Viruses and National Center for Biotechnology Information GenBank accession numbers were used in these analysis: Apple chlorotic leaf spot virus (ACLSV, AB326224), APCLSV (Plum, AY713379; Peach, NC_00694 6), Cherry mottle leaf virus (CMLV, AF170028), Grapevine berry inner necrosis virus (GINV, KU234316), Grapevine Pinot gris virus (GPGV, KF686810), Peach mosaic virus (PcMV, DQ117579), Phlomis mottle virus (PhMV, AM920542).


Fig. 3.

Amino acid sequence alignment of two reported isolates and Yeongcheon isolate of Apricot pseudo-chlorotic leaf spot virus (APCLSV). Two reported isolate sequences from National Center for Biotechnology Information (NCBI) GenBank (APCLSV Plum, accession no. AY713379; APCLSV Peach, accession no. NC_006946) and Yeongcheon isolate sequence determined in this study. The homology of the two reported isolates and Yeongcheon isolate was 95.34%.


APCLSV는 2005년에 처음 보고되었으나 그 밖의 특성과 관련된 연구는 미비한 상황으로, 이번 연구에서 처음으로 국내 분포를 확인하였다. 이 바이러스는 접목부 줄기이상(stem grooving) 증상의 자두나무(Prunus salicina)와 곰보(butterarura) 증상의 살구나무(Prunus armeniaca)에서 검출된 보고가 있으나(Liverti 등, 2005), 복숭아나무에서의 구체적인 병징은 보고되지 않았다. 이번 연구에서 APCLSV가 검출된 시료에서 퇴록, 괴저반점, 엽맥퇴록의 병징을 관찰할 수 있었으나, 자두나무와 살구나무에서 보고된 접목부 줄기 이상증상과 곰보증상은 관찰할 수 없었다. 또한, APCLSV가 검출된 모든 시료는 APCLSV 외에 ACLSV, CGRMV, HSVd, PLMVd, PBNSPaV, PNRSV 중 둘 이상의 바이러스 또는 바이로이드와 복합감염되었으므로 병징을 특정하기 어려울 것으로 판단된다. 한편, APCLSV는 Trichovirus의 모식 종(type species)인 ACLSV와 유전적 특성이 유사한 것으로 알려졌으며(Liverti 등, 2005), 이번 실험에서 APCLSV가 검출된 시료에서 모두 ACLSV가 검출되었다. 이러한 사실들을 바탕으로 APCLSV는 ACLSV와 비슷한 감염 양상을 보일 것으로 생각된다. 따라서, APCLSV의 전염 방법과 생물학적 특성 조사 등을 통해 복숭아를 포함한 과수 농가에 대한 피해를 예방할 필요가 있다.

요약

2016년 5월, 우리나라 복숭아의 주요산지인 경북 영천 지역에서 퇴록, 괴저반점, 엽맥퇴록, 황화와 같은 바이러스 병징과 이상증상을 보이는 복숭아 잎 24점을 채집하였다. 이 시료들의 바이러스 감염 여부를 확인하기 위해 RT-PCR 진단법을 이용하여 진단하였다. 진단 대상은 검역 병원체로 지정된 바이러스 또는 바이로이드를 중심으로, 국내외 연구를 참고하여 국내 발생가능성이 높거나 발생 시 위험도가 높은 종 17종이다. 진단 결과, 국내에서 보고된 적이 없는 바이러스 1종(Apricot pseudo-chlorotic leaf spot virus, APCLSV)과 검역 바이로이드 1종(Peach latent mosaic viroid, PLMVd)을 포함하여, 총 7종의 바이러스와 바이로이드가 검출되었다. 바이러스를 동정하기 위해, RT-PCR 산물을 sequencing하여 확인하였다. 또, 국내 미보고 종인 APCLSV가 검출된 시료를 이용하여 APCLSV의 외피단백질을 암호화하고 있는 염기서열을 증폭하여 결정하였다. 결정된 염기서열은 기보고된 APCLSV 분리주와 97%의 상동성을 보였다. 이 외피단백질 염기서열을 Trichovirus속 바이러스들과 비교 분석하여, 최종적으로 APCLSV임을 확인하였다. 동정된 APCLSV를 Yeongcheon 분리주로 명명하고 결정된 외피단백질 염기서열은 NCBI GenBank에 등록하였다. APCLSV의 발생 양상을 보면, APCLSV가 검출된 시료들은 모두 Apple chlorotic leaf spot virus (ACLSV)가 복합감염되어 있었으며, APCLSV는 ACLSV와 유전학적 유연관계가 가까운 것으로 알려져 있다. ACLSV의 특성에 비추어 볼 때, APCLSV는 국내 과수 농가에 널리 퍼질 가능성이 높을 것으로 생각된다. 따라서, 추후 국내 농가에 미칠 영향 등에 관련된 연구가 필요하다.

Acknowledgement

This research was supported by “Evaluation of adaption of cultivated area and development of cultivation manual of new peach and nectarine cultivars (Project code No. PJ0101772016)” and a cooperative research program (Project code No. PJ010177052016) by National Institute of Horticultural and Herbal Science, Rural Development Administration, Republic of Korea.

References
  1. Bae Y. S (2015) Development of multiplex RT-PCR for apple viruses and viroid and the incidence of apple viral disease in Gyeongsangbuk-do. Master’s thesis . Kyungpook National University, Daegu, Korea.
  2. Bajet N. B, and Unruh T. R. (2008) Occurrence of two little cherry viruses in sweet cherry in Washington State. Plant Dis 92, 234-238.
    CrossRef
  3. Cheong E. J, Kim C. S, Kinard G, and Li R. (2015) Evaluation of the status of the virus and viroid infection in flowering cherry (Prunus yedoensis) collections in Korea and the U.S. J. Plant Pathol 97, 155-160.
  4. Cho I. S, Cho J. D, Choi S. K, and Choi G. S. (2012) Occurrence of stone fruit viruses on peach trees (Prunus persica L. Batsch) in Korea. Res. Plant Dis 18, 391-395.
    CrossRef
  5. Cui H. G, and Hong N. (2011) First report of Plum bark necrosis stem pitting-associated virus in stone fruit trees in China. Plant Dis 95, 1483.
    CrossRef
  6. Fauquet C. M, Mayo A. M, Maniloff J, Desselberger U, and Ball L. A. (2005). Virus Taxonomy . Elsevier-Academic Press, Amsterdam, the Netherlands.
  7. Jo Y, Choi H, Cho J. K, Yoon J. Y, Choi S. K, and Cho W. K. (2016a) First report of Peach latent mosaic viroid in peach trees in Korea. Plant Dis 100, 234.
    CrossRef
  8. Jo Y. H, Chu H. S, Cho J. K, Lian S, Choi H. S, and Cho W. K. (2016b) First report of Hop stunt viroid in peach trees in Korea. Plant Dis 100, 2543.
    CrossRef
  9. Kim H. R, Lee S. H, Shin I. S, Kim J. H, Cho K. H, Heo S, Kim J. S, and Choi Y. M. (2009) Characterization of Prunus necrotic ringspot virus isolate from peach in Korea. Res. Plant Dis 15, 170-174.
    CrossRef
  10. Kofalvi S. A, Marcos J. F, Cañizares M. C, Pallás V, and Candresse T. (1997) Hop stunt viroid (HSVd) sequence variants from Prunus species: evidence for recombination between HSVd isolates. J. Gen. Virol 78, 3177-3186.
    Pubmed CrossRef
  11. Lee S. H, Kim H. R, Kim J. H, and Kim J. S. (2004) Improvement of RT-PCR sensitivity for fruit tree viruses by small-scale dsRNA extraction and sodium sulfite. Plant Pathol. J 20, 142-146.
    CrossRef
  12. Lee S. Y, Yea M. C, Back C. G, Choi K. S, Kang I. K, Lee S. H, and Jung H. Y. (2014) Survey of Cherry necrotic rusty mottle virus and Cherry green ring mottle virus incidence in Korea by Duplex RT-PCR. Plant Pathol. J 30, 445-449.
    Pubmed KoreaMed CrossRef
  13. Lim S, Igori D, Yoo R. H, Zhao F, Cho I. S, Choi G. S, Lim H. S, Lee S. H, and Moon J. S. (2015) Genomic detection and characterization of a Korean isolate of Little cherry virus 1 sampled from a peach tree. Virus Genes 51, 260-266.
    Pubmed CrossRef
  14. Liverti D, Marais A, Svanella-Dumas L, Dulucq M. J, Alioto D, Ragozzino A, Rodoni B, and Candresse T. (2005) Characterization of Apricot pseudo-chlorotic leaf spot virus a novel trichovirus isolated from stone fruit trees. Phytopathology 95, 420-426.
    Pubmed CrossRef
  15. Menzel W, Jelkmann W, and Maiss E. (2002) Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. J. Virol. Methods 99, 81-92.
    CrossRef
  16. Niu F. Q, Pan S, Wu Z. J, Jiang D. M, and Li S. F. (2012) First report of Apricot pseudo-chlorotic leaf spot virus infection of peach in China. J. Plant Pathol 94, S4.86.
  17. Park E. H (2015) Identification and characteristic of Cucumber mosaic virus from Prunus persica L. BATSCH. Master’s thesis . Kyungpook National University, Daegu, Korea.
  18. Park S. J, Nam M, Kim J. S, Lee Y. H, Lee J. B, Kim M. K, Lee J. S, Choi H. S, Kim J. S, Moon J. S, and Kim H. G. (2011) First report of the virus diseases in victory onion (Allium victorialis var platyphyllum). Res. Plant Dis 17, 66-74.
    CrossRef


June 2017, 23 (2)
  • Crossref Similarity Check logo