search for


Occurrence of Viruses Infecting Foxtail Millet (Setaria italica) in South Korea
Res. Plant Dis. 2017;23:69-74
Published online March 31, 2017
© 2017 The Korean Society of Plant Pathology.

Chung Youl Park1,†, Hyun-Geun Min1,†, Hong-Kyu Lee1, Yoon Ah Yeom1, Jonghee Oh1, Bong-Sub Kim2, Dae-Hyeon Bae2, Young-Nam Yoon2, and Su-Heon Lee1,3,*

1School of Applied Biosciences, Kyungpook National University, Daegu 41566, Korea,
2Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang 50426, Korea,
3Institute of Plant Medicine, Kyungpook National University, Daegu 41566, Korea
Tel: +82-53-950-5763 Fax: +82-53-950-6758 E-mail:
Received August 19, 2016; Revised November 18, 2016; Accepted January 29, 2017.
cc This is an open access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

In 2015, a nationwide survey was carried out to investigate about occurrence pattern of virus infecting foxtail millet. A total 100 foxtail millet leaf samples showing virus-like and abnormal symptoms were collected in the seven main cultivated regions of Korea. Four viruses were identified using reverse transcription polymerase chain reaction and RNA sequencing. Of the collected 100 foxtail millet samples, 10 were Barley virus G (BVG), 4 were Rice stripe virus (RSV), 1 was Northern cereal mosaic virus (NCMV), and 1 was Sugarcane yellow leaf virus (ScYLV) infection. To our best knowledge, this is the first report of BVG and NCMV infecting foxtail millet in Korea and ScYLV is expected as new Polerovirus species. This research will be useful in breeding for improved disease-resistant foxtail millet cultivars.

Keywords : Barley virus G, Foxtail millet, Rice stripe virus, RNA sequencing

조(foxtail millet)는 화본과의 한해살이풀로서(Ha와 Lee, 2001), 원산지는 중앙아시아와 동북아시아로 알려져 있다(Li와 Wu, 1996). 동유럽, 중앙아시아, 동아시아 지역에서는 주요 곡물로서 재배되고 있으며, 아프리카, 아메리카, 호주 등에서는 조류 등의 사료용으로 일부 재배되고 있다(De Wet 등, 1979). 국내에서 조는 1960년대까지 주요 작물로 널리 재배되었으며(Kim 등, 2009), 주로 엿, 떡, 소주 등의 일부 재료로 이용되었다(Ha와 Lee, 2001). 이후, 조의 재배는 벼와 밀 등 주요 작물과 비교하여 수량과 수익성이 낮아 생산량이 지속적으로 감소하였다. 통계청 보고에 따르면, 조의 생산량은 2004년 2,644톤에서 2009년 1,360톤으로 급격히 감소하였다(Kim, 2012; 통계청). 최근 건강에 대한 관심이 높아지면서 조와 같은 잡곡은 웰빙식품, 기능성식품에 대한 소비자의 선호도가 높아지며 관심이 증대하고 있지만(Lee 등, 2012), 수량과 직접적인 관련이 있는 병해충에 관한 체계적인 연구들은 부족한 실정이다. 조의 경우 현재까지 2종의 바이러스(Rice black-streaked dwarf virus [RBSDV], Rice stripe virus [RSV])만이 보고되어 있어 바이러스 무병종자의 보급과 저항성 품종 개발 등의 연구에 제한적일 수밖에 없다. 따라서 본 연구에서는 국내 조에서 발생하는 바이러스 조사를 수행하였으며, next generation sequencing (NGS)와 reverse transcription-polymerase chain reaction (RT-PCR) 방법을 기반으로 국내 미보고 및 신종바이러스 동정에 대하여 언급하였다.



2015년 5월부터 9월까지, 조 시료 확보를 위하여 국내에서 재배면적이 가장 넓은 5개 도 7개 시군구(강원도 영월군, 횡성군, 경상남도 밀양시, 경상북도 의성군, 전라남도 나주시, 여수시, 제주도 제주시)에 위치한 포장에서 조사를 수행하여 전체 100점의 시료를 수집하였다(Fig. 1). 육안진단을 통하여 조가 재배되고 있는 포장에서 관찰된 주요 병징으로는 괴저반점, 모자이크, 기형, 엽맥 황화 증상이었으며, 이상증상을 보이는 식물체 또한 시료수집 대상에 포함하였다(Fig. 2).

Fig. 1.

Map of South Korea showing the location of the five provinces where foxtail millet samples collected in 2015. Numbers indicate collected sample number.

Fig. 2.

Various virus symptoms of foxtail millet naturally infected in the field. (A, D) Chlorotic stripe. (B, C) Yellowing streaking.

RT-PCR을 이용한 바이러스 진단

전체 100점의 시료는 Easy-Spin Total RNA extraction Kit (iNtRON Biotechnology, Daejeon, Korea)를 이용하여 공급사의 매뉴얼에 따라 전체 RNA를 추출하였다. 추출한 전체 RNA는 국내에 보고된 2종의 바이러스(RSV, RBSDV)와 문헌조사를 통하여 국외 조에서 발생 보고된 바이러스 14종에 대하여 특이적 프라이머를 설계하여(Table 1) RT-PCR 진단을 수행하였다. RT-PCR 진단 결과 양성반응을 보인 시료에 대해서는 direct seqeuncing을 이용하여 염기서열을 결정하였고, 미국 국립생물정보센터(National Center for Biotechnology Information, NCBI)의 BLAST 검색을 통하여 동정하였다. 전체 16종의 바이러스에 대하여 RT-PCR 진단을 수행한 결과 2종(RSV와 Northern cereal mosaic virus [NCMV])의 바이러스가 검출되었으며, 전체 100점의 시료 중에서 RSV는 4점, NCMV는 1점이 양성반응을 보였고, RBSDV를 포함한 14종은 모두 음성반응을 보였다. NCBI BLAST 결과 검출된 RSV는 기보고된 YG-JN 분리주(GenBank accession no. GQ229098, 97%), NCMV는 Hebei 분리주(GU985153, 99%)와 가장 높은 뉴클레오티드 상동성을 보였다.

Primer pairs used for detection of reported virus from foxtail millet

Acronym*PrimerOligonuleotide sequence (5’ to 3’) Amplicon size (bp)  Target gene

*The acronym and GenBank accession number used is: BSMV (Barley stripe mosaic virus, NC003481), CMMV (Cocksfoot mild mosaic virus, U13918), JGMV (Johnsongrass mosaic virus, AY387828), MCDV (Maize chlorotic dwarf virus, GU594293), MCMV (Maize chlorotic mottle virus, GU594293), MDMV (Maize dwarf mosaic virus, FM883223), MRDV (Maize rough dwarf virus, LK392325), MSV (Maize streak virus, NC001346), NCMV (Northern cereal mosaic virus, NC001346), PCV (Peanut clump virus, L07269), RMV (Ribgrass mosaic virus, HQ667978), RBSDV (Rice black-streaked dwarf virus, JX994211), RDV (Rice dwarf virus, U36565), RSV (Rice stipe virus, GU230170), SrMV (Sorghum mosaic virus, KJ541740), and SCMV (Sugarcane mosaic virus, DQ842502).

Beta, beta B gene; -, no annotation; CP, coat protein gene; S, S-protein gene; p10, p10 protein gene; 3, 3 protein gene; p49, p49 protein gene; MP, movement protein gene; 3’, 3’ UTR; CI, cylindrical inclusion protein gene.

RNA sequencing 분석 및 바이러스 감염양상

수집한 조 시료에 대하여 국내미보고 또는 신종 바이러스 등 추가적인 바이러스를 검출하기 위하여 RNA sequencing 방법을 수행하였다. 전체 100점의 시료는 액체질소를 이용하여 곱게 마쇄한 뒤 혼합하여 1점의 시료로 만들었으며, 위에서 사용한 키트를 이용하여 전체 RNA를 추출하였다. 혼합시료에서 추출한 전체 RNA 1점은 ILLUMINA Hiseq 2500 (Illumina Inc., San Diego, CA, USA) 장비를 이용하여 paired-end RNA sequencing 방법으로 10 Gbp (giga base pair) 생산하였으며, 모든 과정은 Theragen Etex Bio Institute (Suwon, Korea)에서 수행하였다. RNA sequencing을 통하여 확보된 raw sequencing data는 식물바이러스 유래의 시퀀스만을 검출하기 위해 구축된 파이프라인(pipeline)을 이용하여 분석하였으며, 분석은 Seeders (Daejeon, Korea)에서 수행되었다. 분석이 완료된 모든 콘틱(contig)은 NCBI BLAST 검색을 통하여 최종적으로 확인하였다. RNA-sequencing을 통하여 4종의 바이러스(Barley virus G [BVG], RSV, NCMV, Sugarcane yellow leaf virus [ScYLV])가 확인되었으며, 각 바이러스별 검출 콘틱 개수는 Table 2에 표시된 바와 같다. RNA sequencing 결과를 확인하기 위하여 획득한 염기서열 정보를 바탕으로 프라이머를 설계하였으며(Table 3), RT-PCR, 클로닝 그리고 염기서열 분석 수행하여 최종적으로 바이러스를 동정하였다. RT-PCR을 수행한 결과 혼합시료에서 추출한 전체 RNA에서 4종의 바이러스가 모두 양성반응을 보였다(Fig. 3). 개별진단을 수행한 결과 BVG는 10점, NCMV는 1점, ScYLV는 1점, RSV는 4점이 검출되었으며, NCMV와 RSV는 종 특이적 프라이머를 이용한 RT-PCR 진단 결과와 동일하였다. 이 중에서 BVG와 ScYLV, BVG와 RSV의 복합감염이 각각 1점씩 확인되었으며, 84점의 시료에서는 바이러스가 검출되지 않았다(Table 4). 4종의 바이러스에 대하여 염기서열을 결정한 후, NCBI BLAST를 이용하여 상동성을 분석한 결과 RSV와 NCMV는 위의 염기서열 상동성 결과와 동일하였고, BVG는 김제 분리주(KT962089, 98%), ScYLV는 Hainan 분리주(HQ342888, 77%)와 가장 높은 상동성을 보였다. 최종 동정된 4종의 바이러스 중에서 국내 미보고 바이러스 2종(BVG [LC159487], NCMV [KU297992])은 NCBI GenBank에 등록하였다. 추가적으로, ScYLV는 RNA-sequencing을 통하여 획득한 2개의 콘틱을 바탕으로 전체 외피단백질(coat protein, 아미노산 상동성: 82%)과 이동단백질(movement protein, 88%)을 결정하였다. International Committee on Taxonomy of Viruses (ICTV)의 Luteoviridae 신종 분류 기준(암호화된 단백질 상동성 10% 이상의 차이를 보이는 종에 대하여 신종바이러스로 간주하는 규정)에 따라 Polerovirus속의 신종으로 동정하였다.

List of the identified viruses from foxtail millet using RNA sequencing

 Virus name Acronym Genus No. of contigs 
Barley virus GBVGPolerovirus6
Northern cereal mosaic virusNCMVCytorhabdovirus3
Rice stripe virusRSVTenuivirus123
Sugarcane yellow leaf virusScYLVPolerovirus2

Primer sets used for confirmation of the virus existence in samples

 Virus name (acronym)Primer nameOligonucleotide sequence (5’→3’)Amplicon size (bp)
Northern cereal mosaic virus (NCMV) NCMV-0FGGACAATCCATCCAGAAGAAA425
Sugarcane yellow leaf virus (ScYLV)ScYLV-CT-F5ATAGGTAGGCGACGCTCC822

Fig. 3.

Reverse transcription polymerase chain reaction (RT-PCR) for virus detection in foxtail millet. Lane M, size marker; lane 1, Barley virus G (BVG, 568 bp); lane 2, Northern cereal mosaic virus (NCMV, 425 bp); lane 3, Rice stripe virus (RSV, 571 bp); lane 4, Sugarcane yellow leaf virus (ScYLV, 822 bp).

Survey of virus infection in foxtail millet at seven locations of five provinces in 2015

 InfectionVirus name*Location Total 

 H  Y  U  M  N  Y  J 
Single infectionBVG002120510
Double infection BVG+RSV00000011
Non detected1410244176984

*BVG, Barley virus G; NCMV, Northern cereal mosaic virus; RSV, Rice stripe virus; ScYLV, Sugarcane yellow leaf virus.

H, Hoengseong; Y, Yeongwol; U, Uiseong; M, Miryang; N, Naju; Y, Yeosu; J, Jeju.

본 연구에서는 전국적으로 재배되고 있는 조를 수집하여 바이러스병의 종류와 발생 실태를 구명하고자 하였다. 연구 수행 결과, 현재까지 기보고된 1종(RSV) 이외에 추가적으로 미보고 2종(BVG와 NCMV)과 신종으로 예상되는 바이러스 1종(ScYLV-like)을 동정하였다. 추후 본 연구에서 동정한 바이러스에 대한 전파양식, 특성 등에 대한 연구와 위의 바이러스에 대한 피해해석 및 대응기술이 확립되어야 할 것으로 생각된다.


2015년, 조 바이러스 발생양상을 구명하기 위하여 전국적인 조사를 실시하였다. 주요재배단지 7개 지역에서 이상증상과 바이러스 병징을 보이는 식물체 100점을 수집하여, RT-PCR 진단과 RNA sequencing 방법을 이용하여 전체 4종의 바이러스를 동정하였다. 수집한 시료에서는 Barley virus G (BVG)가 10점, Rice stripe virus (RSV)는 4점, Northern cereal mosaic virus (NCMV), Sugarcane yellow leaf virus (ScYLV)가 각각 1점씩 검출되었다. 이들 중에서 BVG와 NCMV는 국내 조에서 첫 발생보고이며, ScYLV는 Polerovirus속의 신종으로 예상된다. 본 연구결과는 조 식물체의 무병종자와 저항성 품종개발을 위한 기초연구 자료로 이용 가능할 것으로 생각된다.


This research was supported by a grant from National Institute of Crop Science, Rural Development Administration, Republic of Korea (Project No. PJ0111282016).

  1. De Wet J. M. J, Oestry-Stidd L. L, and Cubero J. I. (1979) Origins and evolution of foxtail millets (Setaria italica). J. d’Agric. Trad. Bota. Appl 26, 53-64.
  2. Ha Y. D, and Lee S. P. (2001) Characteristics of proteins in Italian millet, sorghum and common millet. Korean J. Postharvest Sci. Technol 8, 187-192.
  3. Kim E. J (2012) Genetic variation of foxtail millet [Setaria italica (L.) P. Beauv.] among accessions collected from Korea and other countries by morphological and molecular markers. Master’s thesis , 64. Kangwon National University, Chuncheon, Korea.
  4. Kim S. K, Sohn E. Y, and Lee I. J. (2009) Starch properties of native foxtail millet Setaria italica Beauv. J. Crop Sci. Biotechnol 12, 59-62.
  5. Lee J. S, Oh B. G, Song S. B, Ko J. Y, Woo K. S, Nam M. H, Park S. T, Kim J. I, Seo M. C, Kwak D. Y, Jung T. W, Oh I. S, and Kim K. Y. (2012) A medium maturing, glutinous foxtail millet (Setaria italica Beauv.) variety ‘Kyeongkwan1’. Korean J. Breed. Sci 44, 369-372.
  6. Li Y, and Wu S. (1996) Traditional maintenance and multiplication of foxtail millet (Setaria italica (L.) P. Beauv.) landraces in China. Euphytica 87, 33-38.

March 2017, 23 (1)
  • Crossref Similarity Check logo