Research in Plant Disease

Table. 1.

Table. 1.

List of primers used to detect four aphid-transmitted strawberry viruses

VirusPrimerSequence (5’→3’)Reference or GenBank databaseGeneSize (bp)
SMYEVCFACAATCGCCCTGGTCAGTAATTCCKwon et al. (2018)CP729
CRTGGAGCTGGGTAGAAGAAGTGAGA
SMoV3UFCGACAGTTCTCTATGTAGGACACCAJ311875a, AJ311876b, KU177218a, KU177219b3' UTR782
3URCATCTATCTAAAGTTAAGTCTACAKU200454b, KU200457b, KU200459b, KU200461b
SCVRdFATATCCGGATTTGAGAACAAY250986, AY331389, AY331386, AY331390,RdRp527
RdRCCTTAACATTGGTGGCAGACAY331385, AY331387, AY331388
SVBVCFAGAGAAAGACTCGAACAATGHE681085, KT250632, MH894295, X97304,CP959
CRCCATATTGTGTTTCCGGTGAKR080547, KP311681, KX950836, KX787430

SMYEV, Strawberry mild yellow edge virus; SMoV, Strawberry mottle virus; UTR, untranslated region; SCV, Strawberry crinkle virus; RdRp, RNA-dependent RNA polymerase; SVBV, Strawberry vein banding virus; CP, coat protein.

For RNA1.

For RNA2.

Res. Plant Dis. 2019;25:226-32 https://doi.org/10.5423/RPD.2019.25.4.226
© 2019 Res. Plant Dis.