Research in Plant Disease

Table. 2.

Table. 2.

Primers used for quantitative real-time PCR

Gene locusForward primer (5’-3’)Reverse primer (5’-3’)
MGG_00204T0GTCAAACATTTACCTCGCGCCATAAAGATTGAACCGCCCAG
MGG_00222T0CACCATCTACTCAAACCCCTCTCGAATTGTGGACAGAGCAAG
MGG_00464T0TCCTCTTCACCAACAGCATGGACCAGAGGAAATACGACACC
MGG_00621T0TGTGACCTTGTGCTCTTGTGGACGTGCAACCTCTTTTCATG
MGG_00752T0CTTTGTCGGTGTTTTCCTCAGGCAGCGGAACGAATTTGAAG
MCK1GGTTTTATGCCGGATTTGAGCTCTGTGGGAGCATTTGACTG
MGG_01117T0TCCCAGAAAGTGACCATCAAGGGTCCAAGAACTGAGTGAAGG
MGG_01507T0ATGCCGTCAGAAGCTTATCGCTGCCATTTTCTTATCTCTTTCCG
MGG_02313T0ACAGTATTTCTCCGCCTCAAGTGCCAATATTCGTCTGTGTCC
MGG_03178T0GCCAAGATCATACACTAGACGAGAATCTAACTTGGCTGTCGGG
MGG_03531T0TGGCTTTGATACTGGAACGAGTGAGTGGTTCATGAGGGTTG
MGG_03694T0CCACGATCAGAACAGGAAGGCAGGATAAAGGACATGGAGCTG
MGG_03918T0TCAGCGAATACAAGGACACGCTCTTGGTGATACTGAAGTGGG
MGG_04121T0TTGTCTCGTATGGCTTCAGTGTTCTTAAGTCTCGCGCCAAG
MGG_04212T0CAATGGCACAAACGGTACAGCAAACCCCACGCAAATCAG
MGG_04407T0GTCTGTTGAGAAGCTGTTGCGGACTAGAGCTTGAACTTGGG
MGG_04538T0AGATGTGCCATATTTGCCCCTGACTGTAGCGTTCTCCAAAG
MGG_05592T0AGCTCATCGACTTTGCCTACGGGTTTCGGTCTCGTAGAAG
MGG_05814T0ATCTTGGTCAACTCGCTCATCAGTGAAAGTACTGGATGACGC
MGG_06296T0CCAACTCGACAACGCTCTATGACGAAGCAGAAACCGCAG
MGG_06910T0TGCCAGGTTGATGTTCGTGCCGTGATGTCCTTGTAGTGAG
MGG_06999T0TCCAAAAGTCTCAGTGTCGCAATCTGCCCCTGAAACGG
MGG_08101T0CAAATGGAGAGGTTCAAAGCGTGTCGATCATGTTCCCAAGG
MGG_08114T0AGCCATGTTAAGGAGATGCAGTTCAGTCCATTCATCCCACG
MGG_08303T0ATGTGGCGATGAAGGTCTGGATTTGAGTTTGCTGTCCGTG
MGG_10035T0CATAGTCATTCTTGTCCCACCCATGAGCTTGTTCTCGGTCG
MGG_10380T0TGACCTTTAGCCACGACATTGTCAATCCAGATGAGCTTGGTG
MGG_10431T0AAACCAAACAATGCAGCCGCCCCATGTACTTGTAGCAGTAG
MGG_10668T0ACTACCTAAAGAAACGGCGACCCAGATCGCCAAATACTAGACC
MGG_11494T0AGTGGACAACGGGCATTTAGGCAACACCAGACACTATACCTC
MGG_11809T0CATCACACTTGGCTTTTGGGTCCCTTCATTGTCCCCTTTG
MGG_13902T0TCATCGACCTTTTCAGCCGAAACAAGTCTCCCAGGTTCC
MGG_14593T0GAGGCCGAATGTTTAGAGCTAGGGCATGACTTTTGTTTTCGTTG
MGG_14683T0GCACTTTCACATCTTTCTCGGTTGAGCGTCTGAGTTTGAGG
MGG_14684T0GTGATCAGCTCGTACCTCAGATCTGCGCTGTATCCCATG
MGG_14741T0AGCAGGTAAGGCCAACTAATGGAGTACTTGGACATCGGAATCG
MGG_15150T0TCACGAAAACCCCATCTCATGTGATGTTGAAGGAGCGAGTG
MGG_15282T0TTCGAGTCATTGGGATCTTGGAGGAACTTGGTCGGCATATC
MGG_16167T0CTTGCCATCAAACTCGACAACTTCTGTGGTATGTGGGTTGG
MGG_16535T0CAGATAGAGCAACAGAGGCAGGTCCATGGTCCTGCATTTTG
MGG_17376T0GCCGATGCTTGTATTACCAACCAGAGTATGAGGTGCTGTAGTG
MGG_17847T0CTTGCCATCAAACTCGACAACTTCTGTGGTATGTGGGTTGG
β-TubulinACAACTTCGTCTTCGGTCAGGTGATCTGGAAACCCTGGAG
Res. Plant Dis. 2019;25:205-12 https://doi.org/10.5423/RPD.2019.25.4.205
© 2019 Res. Plant Dis.